Transcript asmbl_32752

Sequence
Transcript Sequence for observation asmbl_32752 of TGE0056176:
CTTAGGCCCCGTCTCACCCTTTCGGATGCCTCCCCTAGAACCCTACCACTTTCCACCCCTTTCCGTCTGTTATTTCTCCCAAACTTGCGCCCGCACAGGCCCCTCTGGAACACTCCTGCCCCGTAGTGCCCCTCGTCCCCGCTCCGTAGAGAAAGAGCGTGCGTGCCGCGCATTTCTGGCCTGGGGAGCGGGTGGAGTAAACCTGCGGGAACCATTTTACGACAACGTGCGGCTGTGCGGTGTGGCTGACGGCAACGCCGCTGCTCTTGGAGAGGTCACTCCGGAGACGGCGTTGGTTTTGGGGTGTGGGGGGTTGGTGGCACTATGTGGCGCGTCTGTGCGCGACGGGCTCAGAATGTAGCCCCATGGGCGGGACTCGAGGCTCGGTGGACGGCCTTGCAGGAGGTACCCGGAACTCCACGAGTGACCTCGCGATCTGGCCCGGCTCCCGCTCGTCGCAACAGCGTGACTACAGGGTATGGCGGGGTCCGGGCACTGTGCGGCTGGACCCCCAGTTCTGGGGCCACGCCGCGGAACCGCTTACTGCTGCAGCTTTTGGGGTCGCCCGGCCGCCGCTATTACAGTCTTCCCCCGCATCAGAAGGTTCCATTGCCTTCTCTTTCCCCCACAATGCAGGCAGGCACCATAGCCCGTTGGGAAAAAAAAGAGGGGGACAAAATCAATGAAGGTGACCTAATTGCAGAGGTTGAAACTGATAAAGCCACTGTTGGATTTGAGAGCCTGGAGGAGTGTTATATGGCAAAGATACTTGTTGCTGAAGGTACCAGGGATGTTCCCATCGGAGCGATCATCTGTATCACAGTTGGCAAGCCTGAGGATATTGAGGCCTTTAAAAATTATACACTGGATTCCTCAGCAGCACCTACCCCACAAGCGGCCCCAGCACCAACCCCTGCTGCCACTGCTTCGCCACCTACACCTTCTGCTCAGGCTCCTGGTAGCTCATATCCCCCTCACATGCAGGTACTTCTTCCTGCCCTCTCTCCCACCATGACCATGGGCACAGTTCAGAGATGGGAAAAAAAAGTGGGTGAGAAGCTAAGTGAAGGAGACTTACTGGCAGAGATAGAAACTGACAAAGCCACTATAGGTTTTGAAGTACAGGAAGAAGGTTATCTGGCAAAAATCCTGGTCCCTGAAGGCACAAGAGATGTCCCTCTAGGAACCCCACTCTGTATCATTGTAGAAAAAGAGGCAGATATATCAGCATTTGCTGACTATAGGCCAACCGAAGTAACAGATTTAAAACCACAAGTGCCACCACCTACCCCACCCCCGGTGGCCGCTGTTCCTCCAACTCCCCAGCCTTTAGCTCCTACACCTTCAGCACCCTGCCCAGCTACTCCTGCTGGACCAAAGGGAAGGGTGTTTGTTAGCCCTCTTGCAAAGAAGTTGGCAGTAGAGAAAGGGATTGATCTTACACAAGTAAAAGGGACAGGACCAGATGGTAGAATCACCAAGAAGGATATCGACTCTTTTGTGCCTAGTAAAGTTGCTCCTGCTCCGGCAGCTGTTGTGCCTCCCACAGGTCCTGGAATGGCACCAGTTCCTACAGGTGTCTTCACAGATATCCCAATCAGCAACATTCGTCGGGTTATTGCACAGCGATTAATGCAATCAAAGCAAACCATACCTCATTATTACCTTTCTATCGATGTAAATATGGGAGAAGTTTTGTTGGTACGGAAAGAACTTAATAAGATATTAGAAGGGAGAAGCAAAATTTCTGTCAATGACTTCATCATAAAAGCTTCAGCTTTGGCATGTTTAAAAGTTCCCGAAGCAAATTCTTCTTGGATGGACACAGTTATAAGACAAAATCATGTTGTTGATGTCAGTGTTGCGGTCAGTACTCCTGCAGGACTCATCACACCTATTGTGTTTAATGCACATATAAAAGGAGTGGAAACCATTGCTAATGATGTTGTTTCTTTAGCAACCAAAGCAAGAGAGGGTAAACTACAGCCACATGAATTCCAGGGTGGCACTTTTACGATCTCCAATTTAGGAATGTTTGGAATTAAGAATTTCTCTGCTATTATTAACCCACCTCAAGCATGTATTTTGGCAATTGGTGCTTCAGAGGATAAACTGGTCCCTGCAGATAATGAAAAAGGGTTTGATGTGGCTAGCATGATGTCTGTTACACTCAGTTGTGATCACCGGGTGGTGGATGGAGCAGTTGGAGCCCAGTGGCTTGCTGAGTTTAGAAAGTACCTTGAAAAACCTATCACTATGTTGTTGTAACTAACTCAAGAATTTCTAAACTCTCCCAGGTCACACTGATTCATTCTTAACAAGATATTTATATGTTATTAAACAGGTGGTTCTTTTTATTTTAACCAGTTATTTTTATTATTGAGTCTGTCCAGATAAGTTATTTATAATGGGCATTACTGAATTTTTAAAATGCCGATTACACCCAAATATTGTGCACATTTAATAATCAGACACCAGATTTTTAGCTCTGTACTCCTAATTAAGGGACATGTATGTGGCCTTGCCTAGCCCTTTGGTGATAAGTACTTCCTCTAGGAAATGTACGATAGGTAGAATTGTGGTTCCCTAAAGACAAGTACATAAAGGTGACCCTGATGAAACCTTGAAGTTCTGAAATTTAACTGCCTAAAATGTTCTCCTTAGATGTGAGAGAAAGAGAAATCAGAAAAATTAATTCTCTTGGGGGAAGGGCTTGAATTGAAGCTTTACTTTAGAATTTAGCCCTGGTTTGAAATTTTCCATTACATGATCTTGGTTTATCATCGATGGGAAGGGTAGAAAACTTCAAGGAAAATAAGTGAAATTTTAAAAGTCAGCATTTTCTTAGACCTCTTCAGCTGATTGTTTATTTTTCTATGAATTCCTACACATGGTTATTCCCCCCTACTTGAGATAATCTAAATATAAACCAGCTACTTGATGTAACTGAGAATTTGTGTGGATATTTATTTAAACAAATGTGTAATTTTGAGTACAGAATTCAACAGTTACCTCCAAAAAAGAAACATTGTTAATATAATTTAACAGAAGTTGTGAAACTAAAATTTTCTAAGATTAACTGGTAGTTCATTGTAAATGAACATAATGAACAGAATTTATGACTCCACTGTGGAAAATGCTATCAAATAACTAAGGAATATATATGGAATAAGTGTACATATGTAAAATATTGTTACTAGAGTTAGATATGTGCCAAAGTCCATTTATCCCAAATCCTGTCTGAAAAGGAGGGGTACATTGGTAAACATTTTGGAGTGCTTAAAAATGCCAAAAACAAAATGGTAATTTCTACTTTGATAAAGTAAAAAAGTTAAATGTGTGTAAAAAAGTGTTCTGTGTCCTTCTACTCCAGCATCGTCTCATGTAAAATAAGAAAGCCCTAAAATACTATTGGAGAGAAAAAATTAACTAGGTTGCTACTTTATTTGCCTAAATACTTTTTTCTATTTTGTTAGATTTTGCCTTTCTTTTGGAAGGAAGGAGGCGATATTCTGGATTATAAAAATGAATTGGGAACATTATCACAATTCCAGACTTTCTATTAATATTTATGTGTTTTAATAAACGTTTGAAATTATTTATGACTACTTAAAATGAATCTGACCAGTGCTTCCTGGTATATGTAATATGTGGAGTTAGCCCCTGAAATTTGCTTTAAGTGTTTCAGTGTTGAATCTGTTTCTAAATATTCATTATTACATGGTACACAAGTGACACTCCATATATTCCACACAGACTTTTACCTTGCTGTATTATTATGAAAACAATACATTAATTTGATTTTTCAGTAATTAGTAATTTTAGGTTGAAGATTATCCAAAAGAAACAAGCTTATCACAAGGGACCATCATCAATATGATCCAAATCTGGTTCAAACATTCAAAACTTCAAAGATAATTCATCTTTCGCTAATGCTTGTGGTTCTGTTGTTCCCTTGAAAAAAAATAAAAACAGTTGCCTTCTAATAAACATTGTTGAGTTAAAAATTAATCTGAGCT