Transcript asmbl_32724

Sequence
Transcript Sequence for observation asmbl_32724 of TGE0057004:
CGCTAGGGGTGCGGGGTTGGGGAGGAGGCCGCTAGTCTACGCCTGTGGAGCCGATACTCAGCCCTCTGCGACCATGGCTGTGCTGGCGGCACTTCTGCGCAGCGGCGCCCGCAGCCGCAGCCCCCTGCTCCGGAGGCTGGTGCAGGAAATAAGATATGTGGAACGGAGTTATGTATCAAAACCCACTTTGAAGGAAGTGGTCATAGTAAGTGCTACAAGAACACCCATTGGATCTTTTTTAGGCAGCCTTTCCTTGCTGCCAGCCACTAAGCTTGGTTCCATTGCAATTCAGGGAGCCATTGAAAAGGCAGGGATTCCAAAAGAAGAAGTGAAAGAAGCATACATGGGTAATGTTCTACAAGGAGGTGAAGGACAAGCTCCTACAAGGCAGGCAGTATTGGGTGCAGGCTTACCTATTTCTACTCCATGTACCACCATAAACAAAGTTTGTGCTTCAGGAATGAAAGCCATCATGATGGCCTCTCAAAGTCTTATGTGTGGACATCAGGATGTGATGGTGGCAGGTGGGATGGAGAGCATGTCCAATGTTCCATATGTAATGAACAGAGGATCAACACCATATGGTGGGGTAAAGCTTGAAGATTTGATTGTAAAAGACGGGCTAACTGATGTCTACAATAAAATTCATATGGGCAGCTGTGCTGAGAATACAGCAAAGAAGCTGAATATTGCACGAAATGAACAGGACGCTTATGCTATTAATTCTTATACCAGAAGTAAAGCAGCATGGGAAGCTGGGAAATTTGGAAATGAAGTTATTCCTGTCACAGTTACAGTAAAAGGTCAACCAGATGTAGTGGTGAAAGAAGATGAAGAATATAAACGTGTTGATTTTAGCAAAGTTCCAAAGCTGAAGACAGTTTTCCAGAAAGAAAATGGCACAGTAACAGCTGCCAATGCCAGTACACTGAATGATGGAGCAGCTGCTCTGGTTCTCATGACGGCAGATGCAGCGAAGAGGCTCAATGTTACACCACTGGCAAGAATAGTAGCATTTGCTGACGCTGCTGTAGAACCTATTGATTTTCCAATTGCTCCTGTATATGCTGCATCTATGGTTCTTAAAGATGTGGGATTGAAAAAAGAAGATATTGCAATGTGGGAAGTAAATGAAGCCTTTAGTCTGGTTGTACTAGCAAACATTAAAATGTTGGAGATTGATCCCCAAAAAGTGAATATCAATGGAGGAGCTGTTTCTCTGGGACATCCAATTGGGATGTCTGGAGCCAGGATTGTTGGTCATTTGACTCATGCCTTGAAGCAAGGAGAATACGGTCTTGCCAGTATTTGCAATGGAGGAGGAGGTGCTTCTGCCATGCTAATTCAGAAGCTGTAGACAACCTCTGCTATTTAAGGAGACAACCCTATGTGACCAGAAGGCCTGCTGTAATCAGTGTGACTACTGTGGGTCAGCTTATATTCAGATAAGCTGTTTCATTTTTTATTATTTTCTATGTTAACTTTTAAAAATCAAAATGATGAAATCCCAAAACATTTTGAAATTAAAAATAAATTTCTTCTTCTGCTTTTTTCTTGGTAACCTTGAAAAGTTTGATACATTTTTGCATTCTGAGTCTATACTTATCGAAATATGG