Transcript asmbl_26170

Sequence
Transcript Sequence for observation asmbl_26170 of TGE0056488:
TGCGTAGAGGTGGACGCTCCCCTCCCCCGCCCGGGGTAACTGAGGACTCCCGCGCGCGGACTCGCTGCGCCCCACCCTCCCTTTCCCCGGGGCCGTCCGGAGAGCGGGGGCGAGCTTGAAAGTTCCAGAACGCTGCGCAACCATGTCCAAGGGACCTGCAGTTGGTATTGATCTTGGCACCACCTACTCTTGTGTGGGTGTTTTCCAGCACGGAAAAGTCGAGATAATTGCCAATGATCAGGGAAACCGAACCACTCCAAGCTATGTCGCCTTTACGGACACTGAACGGTTGATCGGTGATGCCGCAAAGAATCAAGTTGCAATGAACCCCACCAACACAGTTTTTGATGCCAAACGTCTGATTGGACGCAGATTTGATGATGCTGTTGTCCAGTCTGATATGAAACATTGGCCCTTTATGGTGGTGAATGATGCTGGCAGGCCCAAGGTCCAAGTAGAATACAAGGGAGAGACCAAAAGCTTCTATCCAGAGGAGGTGTCTTCTATGGTTCTGACAAAGATGAAGGAAATTGCAGAAGCCTACCTTGGGAAGACTGTTACCAATGCTGTGGTCACAGTGCCAGCTTACTTTAATGACTCTCAGCGTCAGGCTACCAAAGATGCTGGAACTATTGCTGGTCTCAATGTACTTAGAATTATTAATGAGCCAACTGCTGCTGCTATTGCTTACGGCTTAGACAAAAAGGTTGGAGCAGAAAGAAACGTGCTCATCTTTGACCTGGGAGGTGGCACTTTTGATGTGTCAATCCTCACTATTGAGGATGGAATCTTTGAGGTCAAGTCTACAGCTGGAGACACCCACTTGGGTGGAGAAGATTTTGACAACCGAATGGTCAACCATTTTATTGCTGAGTTTAAGCGCAAGCATAAGAAGGACATCAGTGAGAACAAGAGAGCTGTAAGACGCCTCCGTACTGCTTGTGAACGTGCTAAGCGTACCCTCTCTTCCAGCACCCAGGCCAGTATTGAGATCGATTCTCTCTATGAAGGAATCGACTTCTATACCTCCATTACCCGTGCCCGATTTGAAGAACTGAATGCTGACCTGTTCCGTGGCACCCTGGACCCAGTAGAGAAAGCCCTTCGAGATGCCAAACTAGACAAGTCACAGATTCATGATATTGTCCTGGTTGGTGGTTCTACTCGTATCCCCAAGATTCAGAAGCTTCTCCAAGACTTCTTCAATGGAAAAGAACTGAATAAGAGCATCAACCCTGATGAAGCTGTTGCTTATGGTGCAGCTGTCCAGGCAGCCATCTTGTCTGGAGACAAGTCTGAGAATGTTCAAGATTTGCTGCTCTTGGATGTCACTCCTCTTTCCCTTGGTATTGAAACTGCTGGTGGAGTCATGACTGTCCTCATCAAGCGTAATACCACCATTCCTACCAAGCAGACACAGACCTTCACTACCTATTCTGACAACCAGCCTGGTGTGCTTATTCAGGTTTATGAAGGCGAGCGTGCCATGACAAAGGATAACAACCTGCTTGGCAAGTTTGAACTCACAGGCATACCTCCTGCACCCCGAGGTGTTCCTCAGATTGAAGTCACTTTTGACATTGATGCCAATGGTATACTCAATGTCTCTGCTGTGGACAAGAGTACGGGAAAAGAGAACAAGATTACTATCACTAATGACAAGGGCCGTTTGAGCAAGGAAGACATTGAACGTATGGTCCAGGAAGCTGAGAAGTACAAAGCTGAAGATGAGAAGCAGAGGGACAAGGTGTCATCCAAGAATTCACTTGAGTCCTATGCCTTCAACATGAAAGCAACTGTTGAAGATGAGAAACTTCAAGGCAAGATTAACGATGAGGACAAACAGAAGATTCTGGACAAGTGTAATGAAATTATCAACTGGCTTGATAAGAATCAGACTGCTGAGAAGGAAGAATTTGAACATCAACAGAAAGAGCTGGAGAAAGTTTGCAACCCCATCATCACCAAGCTGTACCAGAGTGCAGGAGGCATGCCAGGAGGAATGCCTGGGGGATTTCCTGGTGGTGGAGCTCCTCCCTCTGGTGGTGCTTCCTCAGGGCCCACCATTGAAGAGGTTGATTAAGCCAACCAAGTGTAGATGTAGCATTGTTCCACACATTTAAAACATTTGAAGGACCTAAATTCGTAGCAAATTCTGTGGCAGTTTTAAAAAGTTAAGCTGCTATAGTAAGTTACTGGGCATTCTCAATACTTGAATATGGAACATATGCACAGGGGAAGGAAATAACATTGCACTTTATAAACACTGTATTGTAAGTGGAAAATGCAATGTCTTAAATAAAACTATTTAAAATTGGCA