Transcript asmbl_18314

Sequence
Transcript Sequence for observation asmbl_18314 of TGE0056751:
TTTGGCTTGGCTTGTCAGGGCTTGTCCAGGAGTTCCGCTCCTCTCTCCAACCGGGGTCCCCCTCCAGCGACCCTAAAGCTTCCCAGACTTCCGCTTCAATTCCTGTCCGCACCCCACGCCCACCTCAACGTGGAGCGCAGTGGTCTCCGAGGAGCGCCGGAGCTGCCCCGCCTGCCCAGCGGGGTCAGCACTTCGCATCAAGGCCCAAGAAAAGCAAGTCCTCCAGCGTTCTGAGCACCCGGGCCTGAGGGAAGGTCCTAACAGCCCCCGGGAGCCAGTCTCCAACGCCTCCCGCAGCAGCCCGCCGCTCCCAGGTGCCCGCGTGCGCCGCTGCCGCCGCAATCCCGCACGCGTCCCGCGCCCGCCCCACTTTGCCTATCCCCGGGACTAAGACGGGAATCCTGTGAAGCAGCTCCAGCTATGTGTGAAGAAGAGGACAGCACTGCCTTGGTGTGTGACAATGGCTCTGGGCTCTGTAAGGCCGGCTTTGCTGGGGACGATGCTCCCAGGGCTGTTTTCCCATCCATTGTGGGACGTCCCAGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCACAGAGCAAAAGAGGAATCCTGACCCTGAAGTACCCGATAGAACATGGCATCATCACCAACTGGGACGACATGGAAAAGATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCCTGAAGAGCATCCCACCCTGCTCACGGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAAAATGACTCAAATTATGTTTGAGACTTTCAATGTCCCAGCCATGTATGTGGCTATCCAGGCGGTGCTGTCTCTCTATGCCTCTGGACGCACAACTGGCATCGTGCTGGACTCTGGAGATGGTGTCACCCACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCCATGCCATCATGCGTCTGGATCTGGCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGACTGAGCGTGGCTATTCCTTCGTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCTCTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTACGAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACCCTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACCTACAACAGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTCCTATCAGGGGGCACCACTATGTACCCTGGCATTGCCGACCGAATGCAGAAGGAGATCACGGCCCTAGCACCCAGCACCATGAAGATCAAG