Transcript asmbl_18312

Sequence
Transcript Sequence for observation asmbl_18312 of TGE0056751:
CGTGTTTATCTCCCACAGGCGGCTGAACCGCCTCCCGTTTCATGAGCAGACCAGTGGAATGCAGTGGAAGAGACCCAGGCCTCCGGCCACCCAGATTAGAGAGTTTTGTGCTGAGGTCCCTATATGGTTGTGTTAGACTGAACGACAGGCTCAAGTCTGTCTTTGCTCCTTGTTTGGGAAGCAAGTGGGAGGAGAGCAGGCCAAGGGGCTATATAACCCTTCAGCTTTCAGCTTCCCTGAACACCACCCAGTGTGGAGCAGCCCAGCCAAGCACTGTCAGGAATCCTGTGAAGCAGCTCCAGCTATGTGTGAAGAAGAGGACAGCACTGCCTTGGTGTGTGACAATGGCTCTGGGCTCTGTAAGGCCGGCTTTGCTGGGGACGATGCTCCCAGGGCTGTTTTCCCATCCATTGTGGGACGTCCCAGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCACAGAGCAAAAGAGGAATCCTGACCCTGAAGTACCCGATAGAACATGGCATCATCACCAACTGGGACGACATGGAAAAGATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCCTGAAGAGCATCCCACCCTGCTCACGGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAAAATGACTCAAATTATGTTTGAGACTTTCAATGTCCCAGCCATGTATGTGGCTATCCAGGCGGTGCTGTCTCTCTATGCCTCTGGACGCACAACTGGCATCGTGCTGGACTCTGGAGATGGTGTCACCCACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCCATGCCATCATGCGTCTGGATCTGGCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGACTGAGCGTGGCTATTCCTTCGTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCTCTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTACGAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACCCTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACCTACAACAGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTCCTATCAGGGGGCACCACTATGTACCCTGGCATTGCCGACCGAATGCAGAAGGAGATCACGGCCCTAGCACCCAGCACCATGAAGATCAAG