Transcript asmbl_175297

Sequence
Transcript Sequence for observation asmbl_175297 of TGE0056115:
GGATCCTCGAGGGAGGTGCCGGTTTCTCTCCGCGGGCGCCGTGGGGACGGTGGGAGGCGGGGGCGTCGGCAGCGCTTGGACTAGGTGCGGCCTTGGGCCTGCCTGGTAGCGGGGATTTGGGCCCGCAGAGCGCCCGCCTCTGCGGCTGAGTTCTGCCTGGCGGGGAAGGGAGCGCCCGATGGGTGCCGAGGCGTCCTCCTCTTGGTGCCCTGGCACTGCTCTTCCCGAAGAACGCCTTTCAGTTAAACGGGCGTCGGAAATCTCGGGCTTCCTGGGGCAGGGATCGTCGGGAGAGGCCGCTCTGGACGTGTTGACACACGTGCTGGAGGGGGCAGGAAACAAGCTCACATCTTCCTGTGGGAAACCTTCTAGCAACAGGATGAGTCTGCAGTGGACTGCAGTTGCCACCTTCCTCTATGCGGAGGTCTTTGTTGTGTTGCTTCTCTGCATTCCCTTCATTTCTCCTAAAAGATGGCAGAAGATTTTCAAGTCCCGGCTGGTGGAGTTGTTAGTGTCCTATGGCAACACCTTCTTTGTGGTTCTCATTGTCATCCTTGTGCTGTTGGTCATCGATGCCGTGCGCGAAATTCGGAAGTATGATGATGTGACGGAAAAGGTGAACCTCCAGAACAATCCCGGGGCCATGGAGCACTTCCACATGAAGCTTTTCCGTGCCCAGAGGAATCTCTACATTGCTGGCTTTTCCTTGCTGCTGTCCTTCCTGCTTAGACGCCTGGTGACTCTCATTTCGCAGCAGGCCACGCTGCTGGCCTCCAATGAAGCCTTTAAAAAGCAGGCGGAGAGTGCTAGTGAGGCGGCCAAGAAGTACATGGAGGAGAATGACCAGCTCAAGAAGGGAGCTGCTGTTGACGGAGGCAAGTTGGATGTCGGGAATGCTGAGGTGAAGTTGGAGGAAGAGAACAGGAGCCTGAAGGCTGACCTGCAGAAGCTAAAGGACGAGCTGGCCAGCACTAAGCAAAAACTAGAGAAAGCTGAAAACCAGGTTCTGGCCATGCGGAAGCAGTCTGAGGGCCTCACCAAGGAGTACGACCGCTTGCTGGAGGAGCACGCAAAGCTGCAGGCTGCAGTAGATGGTCCCATGGACAAGAAGGAAGAGTAAGGGCCTCCTTCCTCCCCTGCCTGCAGCTGGCTTCCACCTGGCACGTGCCTGCTGCTTCCTGAGAGCCCGGCCTCTCCCTCCAGTACTTCTGTTTGTGCCCTTCTGCTTCCCCCATTCCCTTCCACAGCTCATAGCTCGTCATCTCGGCCCTTGTCCACACTCTCCAAGCACATTACAGGGGACCTGATTGCTACACGTTCAGAATGCGTTTGCTGTCATCCTGCTTGGCCTGGCCAGGCCTGGCACAGCCTTGGCTTCCACGCCTGAGCGTGGAGAGCACGAGTTAGTTGTAGTCCGGCTTGCGGTGGGGCTGACTTCCTGTTGGTTTGAGCCCCTTTTTGTTTTGCCCTCTGGGTGTTTTCTTTGGTCCCGCAGGAGGGTGGGTGGAGCAGGTGGACTGGAGTTTCTCTTGAGGGCAATAAAAGTTGTCATGGTGTGTACGTG