Transcript asmbl_174560

Sequence
Transcript Sequence for observation asmbl_174560 of TGE0056115:
GGATCCTCGAGGGAGGTGCCGGTTTCTCTCCGCGGGCGCCGTGGGGACGGTGGGAGGCGGGGGCGTCGGCAGCGCTTGGACTAGGTGCGGCCTTGGGCCTGCCTGGTAGCGGGGATTTGGGCCCGCAGAGCGCCCGCCTCTGCGGCTGAGTTCTGCCTGGCGGGGAAGGGAGCGCCCGATGGGTGCCGAGGCGTCCTCCTCTTGGTGCCCTGGCACTGCTCTTCCCGAAGAACGCCTTTCAGTTAAACGGGCGTCGGAAATCTCGGGCTTCCTGGGGCAGGGATCGTCGGGAGAGGCCGCTCTGGACGTGTTGACACACGTGCTGGAGGGGGCAGGAAACAAGCTCACATCTTCCTGTGGGAAACCTTCTAGCAACAGGATGAGTCTGCAGTGGACTGCAGTTGCCACCTTCCTCTATGCGGAGGTCTTTGTTGTGTTGCTTCTCTGCATTCCCTTCATTTCTCCTAAAAGATGGCAGAAGATTTTCAAGTCCCGGCTGGTGGAGTTGTTAGTGTCCTATGGCAACACCTTCTTTGTGGTTCTCATTGTCATCCTTGTGCTGTTGGTCATCGATGCCGTGCGCGAAATTCGGAAGTATGATGATGTGACGGAAAAGGTGAACCTCCAGAACAATCCCGGGGCCATGGAGCACTTCCACATGAAGCTTTTCCGTGCCCAGAGGAATCTCTACATTGCTGGCTTTTCCTTGCTGCTGTCCTTCCTGCTTAGACGCCTGGTGACTCTCATTTCGCAGCAGGCCACGCTGCTGGCCTCCAATGAAGCCTTTAAAAAGCAGGCGGAGAGTGCTAGTGAGGCGGCCAAGAAGTACATGGAGGAGAATGACCAGCTCAAGAAGGGAGCTGCTGTTGACGGAGGCAAGTTGGATGTCGGGAATGCTGAGGTGAAGTTGGAGGAAGAGAACAGGAGCCTGAAGGCTGACCTGCAGAAGCTAAAGGACGAGCTGGCCAGCACTAAGCAAAAACTAGAGAAAGCTGAAAACCAGGTTCTGGCCATGCGGAAGCAGTCTGAGGGCCTCACCAAGGAGTACGACCGCTTGCTGGAGGAGCACGCAAAGCTGCAGGCTGCAGTAGATGGTCCCATGGACAAGAAGGAAGAGTAAGGGCCTCCTTCCTCCCCTGCCTGCAGCTGGCTTCCACCTGGCACGTGCCTGCTGCTTCCTGAGAGCCCGGCCTCTCCCTCCAGTACTTCTGTTTGTGCCCTTCTGCTTCCCCCATTCCCTTCCACAGCTCATAGCTCGTCATCTCGGCCCTTGTCCACACTCTCCAAGCACATTACAGGGGACCTGATTGCTACACGTTCAGAATGCGTTTGCTGTCATCCTGCTTGGCCTGGCCAGGCCTGGCACAGCCTTGGCTTCCACGCCTGAGCGTGGAGAGCACGAGTTAGTTGTAGTCCGGCTTGCGGTGGGGCTGACTTCCTGTTGGTTTGAGCCCCTTTTTGTTTTGCCCTCTGGGTGTTTTCTTTGGTCCCGCAGGAGGGTGGGTGGAGCAGGTGGACTGGAGTTTCTCTTGAGGGCAATAAAAGTTGTCATGGTGTGTACGTG