Transcript asmbl_21987

Sequence
Transcript Sequence for observation asmbl_21987 of TGE0004203:
CCTGCCGCAGGTTTCCAATAGCTTCTGCACACCGGAACTCAGGTGGAGCAGAGACCCAGAAGTCCTGCGCTGTTTGGTGAGCGTGTACGCATAGCGCAATCTCGCGTGCTGGCCCGGGGCGAACAGAGCTGCCAGATACTTTGTTGTAAGAAATTGAACATGGCAGAAGAAGAGGACTATATGTCTGATTCCTTCATTAACGTCCAAGAAGATATCAGACCGGGATTGCCAATGCTGAGGCAAATTCGAGAAGCTCGTCGAAAAGAAGAAAAGCAGCAGGAAGCTAATTTGAAAAATAGGCAGAAGAGTTTAAAAGAAGAAGAACAAGAAAGACGTGACATTGGGTTGAAGAATGCACTAGGCTGTGAAAACAAAGGGTTTGCTTTGCTCCAAAAGATGGGATATAAAAGTGGCCAGGCCCTTGGCAAGAGTGGAGATGGTATTGTTGAACCAATTCCTCTCAATGTCAAAACAGGGAAAAGTGGCATTGGTCATGAGGCATTGTTAAAACGGAAAGCAGAGGAAAAATTAGAAAGCTACAGAAGAAAGATTAATGTGAAAAAGCAAACTGAAGAAAAAGCTGCAGAACAGTTTCGAATGCGACTTAAAAATAAGCAAGATGAAATGAAGCTAGAAGGAGATCTTAGAAGAAGCCAGCGAGCCTGTCAACAATTGGATACTCAGAAGAATATTCAGGTTCCCAGGGAGGCCTGGTACTGGTTGAGGCTTGAAGAAGAGACTGAAGAAGAGGAAGAGGAAGAAAAAGAACAAGATGAAGATGAATATAAGAGTGAAGATTTAAGTGTACTGGACAAATTACAAATATTGACTAGTTATTTAAGAGAAGAACATCTGTATTGTATTTGGTGTGGAACAGCCTATGAAGATGAAGAAGACCTGTCTTCACATTGCCCAGGACCAACTTCCGCAGATCACGACTAAGAGTAGTCTCAATAAAGTAGAAATCTGGAAAATGCTGTTATTCTCAAAGACAGATAGTTGAGCAGTTAGAATTCCCAGATTTTGGACACCAGTAAAGAAAGAGGGCCTTATATATTTTGTTCTTTTTCTACTTTCGAAGTCCTTCATACTTTAGAATTGTTCACTGACCTCCAAAAATATAATGGAATGCTATTTCAGAACATGAGTTATAGACACGGGCCATTACAATTTATGACTCTGTTGTGATACTTATGGAGTTTAAGGGACACCAGCAGGTAACTCCCTTATTCCTCTCTTCACTTCAGAACAAATTGAAAAATAAGACATGGGAGCCAGCTTTATTATCAGTGAAGCTGAAATAGACGGCAAGGCTGATTTGTTCTCTAGTCAGACTCCCTAACATAGCTCTGTGATTGGAGAGACTGCAGACCTCGGTGAGAACACAGCCCATTTCACATTTTCAGACTAGTTAGCTTTCAAGGTGACAGAATCTACTAGGGGCTGGGCCACACAGGCTAGGTTCCTTCTCTCAATAGCACTCATCAGATAAGACATC