Transcript asmbl_25701

Sequence
Transcript Sequence for observation asmbl_25701 of TGE0000893:
TGGCTAGGCAGGGGCTGTACGACCGTCTCCCGCCTCTGCCTGTCACTCCGGGCATGGAGGGCGCGGGTGTTGTGATCGCAGTGGGCGAGGGAGTCAGCGACCGCAAGGCAGGAGACCGGGTGATGGTGTTGAACCGGTCAGGGATGTGGCAGGAAGAGGTGACTGTGCCCTCGGTCCAGACCTTCCTGATTCCTGAGGCCATGACCTTTGAGGAAGCTGCTGCCTTGCTCGTCAATTACATTACAGCCTACATGGTCCTCTTTGACTTCGGCAACCTACAGCCTGGCCACAGCGTCTTGGTACACATGGCTGCAGGGGGTGTGGGTATGGCTGCCGTGCAGCTGTGCCGTACAGTGGAGAATGTGACAGTGTTCGGAACGGCCTCGGCCAGCAAGCACGAGGCACTGAAGGAGAATGGGGTCACACATCCCATCGACTATCACACGACTGACTACGTGGATGAGATCAAGAAGATTTCCCCTAAAGGAGTGGACATTGTCATGGACCCTCTGGGTGGGTCAGATACTGCCAAGGGCTACAACCTCCTGAAACCCATGGGCAAAGTCGTCACCTATGGAATGGCCAACCTGCTGACGGGCCCCAAACGGAACCTGATGGCCCTGGCCCGGACATGGTGGAATCAGTTCAGCGTGACAGCTCTGCAGCTGCTGCAGGCCAACCGGGCTGTGTGTGGCTTCCACCTGGGCTACCTGGATGGTGAGGTGGAGCTGGTCAGTGGTGTGGTGGCCCGCCTCCTGGCTCTGTACAACCAGGGCCACATCAAGCCCCACATTGACTCAGTCTGGCCCTTCGAGAAGGTGGCTGATGCCATGAAACAGATGCAGGAGAAGAAGAATGTGGGCAAGGTCCTCCTGGTTCCAGGGCCAGAGAAGGAGAACTAGGGCAAGTGGCTGTGAGACCCTAGAGACCAGCGAAGGGAGAAGTTGGGAAGCTACGTTCTGTTGGCCACCAGACTTGCATTTCAGCCTCTGTCATAATGCTCTGCCCTCCCTCCCCCGAAGGTCTCTGTGGTGATGACCGCTCTCCCCTGCCCCTCCCCGCTTCCTGACCTCTGAAGAGGTTGGGAAGTGACCATTTGGATGTCTGGGCCCTGCCAAGGCGACAGGGAGGGTCAGAGGGAGGCCGGCTGCTTCCTGCCCCCACCCTTTCCCCGGGCCTGCTGTGCTGCTTTTGTGCCAAGGTTAGCCAGTCCCCCCTGTTGTGTTCCATGTGCTTTCACCTCTGCCTCATCTTTCCTCCCGTCCCTGCCCCGCCACCTCCCCAAAGAATTGAAACGTCAGCTCAGGATATGGGGCCAATCTCTGTGAGTCCAGCATGTACCTGTCTCTCCCTAGTGTCCCTTCAGCCTGGGCTGACCAGTGCCCGCCTCTGGGCTTGACCAGTTCCCAATCTCGTCCTCTGTCCCCAACTTCTTAAGCACAATTGGGCTTCTTCCATCTCCAGGTTTTCTGCCATTCTTAACCAAGGCTGCCTCTTCCAACAGGGCGGGAATCAGACCTACTCCCCTAGGTCACAACTCTGGGAAGGATACAGAGCCCCCACCCTTCACTGAGTTCTCTGGATTTGTTCTCAGTGCCTTAGCAACGAAAACCTGTGCTTGTGTGTGTGTGGCGGCGGGGAGGGAGGATCCTGTTTCCCACCTCCTTCTCCTCCCCTGTACTCCCCAGTGCCTTCCTTGTTCTGGTGGAGCTGGGGTTTCTCTCCTCCCCAGTCCCACAACACTGCCAAAAATCTGTGTATGTGCCATTGGGTGGGGCAGCCCCAAGCCTCCTGGGGAGGCAGGGCAAAAACAGGTGCCCTCATCGTGGTCTGTGCCATGTCCCGTCTCTATGGTGGTTGAGGAGAAAGGCGGGGAAGCTTCCTCAGCCTTGCAGATATGTGTGGCATTTACTAGCCAGAGCTCTGAAAGGCAGTGCTGTCTGTTTCTTGTACTGGGACCAAAGTAAAAATCCAAGCACATTCCCCTTGCAGTTAGGGGAGGCCCTACTGCCTTCTCAAAGCAGAGAGGCAGCTTATCAAACTCAGCCCAAAACTCTGTTTACATGGGTGGGGAGATGGAGCAGGGAAGTACAGAGTGGGATGGTCAGGACCTGGGCCATTGCAACCAAAATGGGGACTTCCTGGGTAGGGAGGTCACTCCCTCTACTCACTGAGCTAGGATTAGGGAGGGTTATTGCCCCAACCATTGCAATGGGAGGTGGAGGGACAGGCTCAGCCTCCTCATTGTCTAAATGAGGCCTAAATGTGTGAAGTGCGATTTCTGCTTTTGTGTACCCCACCACCCCATTACCACAGCTGCCTTTGTGTGTTTGTGTCAATAAAAAGCCAAACCCTGGG