Transcript asmbl_166495

Sequence
Transcript Sequence for observation asmbl_166495 of TGE0002774:
GTTCCCAGCACTTGTGCAGACTCCTCCGGGGAAGAGCGGCCTCCGCGGTCATCTCCAACGGAATTCTGCCTTTGAAGTGTCGGGGCACGGCGCGTCGAGGGTCCTGGCGGCCAGGCGGGGCGTGTGCAAGGGTCGCGTCCCCCCCCCGGGCCCCCGGCCCGTGGCTCTTGGTAGAGCCCAGTGCTTCATTTCCCGTGCGCGGCCCGGGCGGCCCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGCTGGCGTGTGAGTACCGCGGCCCCCGCCGGAAGGAGTCGGGCGCGACAGAGACGCCCGAGGGGCCGGGAGGGCGGGCGGCCCGGGCTGCGCCAGAAGCTCGCGCCGTTAGGGACTGAGGCACAAGTGCGCCAGCGCGGGCTTAGGGGCCGTGGGCCAAGTGCGGCACTTGGGGCGAGCGCAGAGAGGCGGGGCGACGGAGGCCACGTGGCCGGCTTGGAGGGCGTCCGCGGGACGGGGGCGCCGGGAGCACTGTCTCACGGCGCATCCCGGTCGTGGAAGCCCCTCGGCCAGGCTGCTGGGGCCTAAGGCCTGTGTTTGCTGCCGTCTCCGTGGGAGACCAGACATCTGCCCCAGCTGTTTCTCTGGCCTGCAGACCTTCGTACACCACGTCTTTGTCAAGCACCAGTTACTGCACGCATCAGCTGAGCACGGAGGGGATAGGCACGGACGCAACACTTTTGGAACTTAGACGCTACAGAAAAATGGCTACAAACTTCCTAGCACATGAGAAGATCTGGTTCGACAAGTTCAAATATGACGACGCAGAAAGGAGATTCTACGAGCAGATGAACGGGCCTGTGGCAGGTGCCTCCCGCCAGGAGAACGGCGCCAGCGTGATCCTCCGTGACATTGCGAGAGCCAGAGAGAACATCCAGAAATCCCTGGCTGGAAGCTCAGGCCCCGGGGCCTCCAGCGGCACCAGCGGAGACCACGGTGAGCTCGTCGTCCGGATTGCCAGTCTGGAAGTGGAGAACCAGAGTCTGCGTGGCGTGGTACAGGAGCTGCAGCAGGCCATCTCCAAGCTGGAGGCCCGGCTGAACGTGCTGGAGAAGAGCTCGCCTGGCCACCGGGCCACGGCCCCACAGACCCAGCACGTATCTCCCATGCGCCAAGTGGAGCCCCCAGCCAAGAAGCCAGCCACACCAGCAGAGGATGACGAGGATGATGACATTGACCTGTTTGGCAGTGACAATGAGGAGGAGGACAAGGAGGCGGCACAGCTGCGGGAGGAGCGGCTACGGCAGTACGCGGAGAAGAAGGCCAAGAAGCCTGCACTGGTGGCCAAGTCCTCCATCCTGCTGGATGTCAAGCCTTGGGATGATGAGACGGACATGGCCCAGCTGGAGGCCTGTGTGCGCTCTATCCAGCTGGACGGGCTGGTCTGGGGGGCTTCCAAGCTGGTGCCCGTGGGCTACGGTATCCGGAAGCTACAGATTCAGTGTGTGGTGGAGGACGACAAGGTGGGGACAGACTTGCTGGAGGAGGAGATCACCAAGTTTGAGGAGCACGTGCAGAGTGTCGATATCGCAGCTTTCAACAAGATCTGAAGCCTGAGTGTGTGTACGTGCGCGCGTGCGTGAGGCCCTGCCACGATTAAAGACTGAGACCGGC