Transcript asmbl_161761

Sequence
Transcript Sequence for observation asmbl_161761 of TGE0002774:
GTTCCCAGCACTTGTGCAGACTCCTCCGGGGAAGAGCGGCCTCCGCGGTCATCTCCAACGGAATTCTGCCTTTGAAGTGTCGGGGCACGGCGCGTCGAGGGTCCTGGCGGCCAGGCGGGGCGTGTGCAAGGGTCGCGTCCCCCCCCCGGGCCCCCGGCCCGTGGCTCTTGGTAGAGCCCAGTGCTTCATTTCCCGTGCGCGGCCCGGGCGGCCCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGCTGGCGTGTGAGTACCGCGGCCCCCGCCGGAAGGAGTCGGGCGCGACAGAGACGCCCGAGGGGCCGGGAGGGCGGGCGGCCCGGGCTGCGCCAGAAGCTCGCGCCGTTAGGGACTGAGGCACAAGTGCGCCAGCGCGGGCTTAGGGGCCGTGGGCCAAGTGCGGCACTTGGGGCGAGCGCAGAGAGGCGGGGCGACGGAGGCCACGTGGCCGGCTTGGAGGGCGTCCGCGGGACGGGGGCGCCGGGAGCACTGTCTCACGGCGCATCCCGGTCGTGGAAGCCCCTCGGCCAGGCTGCTGGGGCCTAAGGCCTGTGTTTGCTGCCGTCTCCGTGGGAGACCAGACATCTGCCCCAGCTGTTTCTCTGGCCTGCAGACCTTCGTACACCACGTCTTTGTCAAGCACCAGTTACTGCACGCATCAGCTGAGCACGGAGGGGATAGGCACGGACGCAACACTTTTGGAACTTAGACGCTACAGAAAAATGGCTACAAACTTCCTAGCACATGAGAAGATCTGGTTCGACAAGTTCAAATATGACGACGCAGAAAGGAGATTCTACGAGCAGATGAACGGGCCTGTGGCAGGTGCCTCCCGCCAGGAGAACGGCGCCAGCGTGATCCTCCGTGACATTGCGAGAGCCAGAGAGAACATCCAGAAATCCCTGGCTGGAAGCTCAGGCCCCGGGGCCTCCAGCGGCACCAGCGGAGACCACGGTGAGCTCGTCGTCCGGATTGCCAGTCTGGAAGTGGAGAACCAGAGTCTGCGTGGCGTGGTACAGGAGCTGCAGCAGGCCATCTCCAAGCTGGAGGCCCGGCTGAACGTGCTGGAGAAGAGCTCGCCTGGCCACCGGGCCACGGCCCCACAGACCCAGCACGTATCTCCCATGCGCCAAGTGGAGCCCCCAGCCAAGAAGCCAGCCACACCAGCAGAGGATGACGAGGATGATGACATTGACCTGTTTGGCAGTGACAATGAGGAGGAGGACAAGGAGGCGGCACAGCTGCGGGAGGAGCGGCTACGGCAGTACGCGGAGAAGAAGGCCAAGAAGCCTGCACTGGTGGCCAAGTCCTCCATCCTGCTGGATGTCAAGCCTTGGGATGATGAGACGGACATGGCCCAGCTGGAGGCCTGTGTGCGCTCTATCCAGCTGGACGGGCTGGTCTGGGGGGCTTCCAAGCTGGTGCCCGTGGGCTACGGTATCCGGAAGCTACAGATTCAGTGTGTGGTGGAGGACGACAAGGTGGGGACAGACTTGCTGGAGGAGGAGATCACCAAGTTTGAGGAGCACGTGCAGAGTGTCGATATCGCAGCTTTCAACAAGATCTGAAGCCTGAGTGTGTGTACGTGCGCGCGTGCGTGAGGCCCTGCCACGATTAAAGACT