Transcript asmbl_149818

Sequence
Transcript Sequence for observation asmbl_149818 of TGE0058082:
CCAGCCTGCTTTCCCTCCGCGCCCTCCCCTCTCCTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACCTGCGGAGAAAAAAAATTACTTATTTTCTTGCCCCATACATACCTTGAGGCGAGCAAAAAAATTAAATTTTAACCATGAGGGAAATCGTGCACATCCAGGCTGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGATCAGTGATGAACATGGCATCGACCCCACCGGCACCTACCACGGGGACAGCGACCTGCAGCTGGACCGCATCTCTGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCCATCCTGGTGGATCTAGAACCTGGGACCATGGACTCTGTTCGCTCAGGTCCTTTTGGCCAGATCTTTAGACCAGACAACTTTGTATTTGGTCAGTCTGGGGCAGGTAACAACTGGGCCAAAGGCCACTACACAGAGGGCGCCGAGCTGGTTGATTCTGTCCTGGATGTGGTACGGAAGGAGGCAGAGAGCTGTGACTGCCTGCAGGGCTTCCAGCTGACCCACTCACTGGGCGGGGGCACAGGCTCTGGAATGGGCACTCTCCTTATCAGCAAGATCCGAGAAGAATACCCTGATCGCATCATGAATACCTTCAGTGTGGTGCCTTCACCCAAAGTGTCTGACACCGTGGTCGAGCCCTACAATGCCACCCTCTCCGTCCATCAGTTGGTAGAGAATACTGATGAGACCTATTGCATTGACAACGAGGCCCTCTATGATATCTGCTTCCGCACTCTGAAGCTGACCACACCAACCTACGGGGATCTGAACCACCTTGTCTCAGCCACCATGAGTGGTGTCACCACCTGCCTCCGTTTCCCTGGCCAGCTCAATGCTGACCTCCGCAAGTTGGCAGTCAACATGGTCCCCTTCCCACGTCTCCATTTCTTTATGCCTGGCTTTGCCCCTCTCACCAGCCGTGGAAGCCAGCAGTATCGAGCTCTCACAGTGCCGGAACTCACCCAGCAGGTCTTCGATGCCAAGAACATGATGGCTGCCTGTGACCCCCGCCACGGCCGATACCTCACCGTGGCTGCTGTCTTCCGTGGTCGGATGTCCATGAAGGAGGTCGATGAGCAGATGCTTAACGTGCAGAACAAGAACAGCAGCTACTTTGTGGAATGGATCCCCAACAATGTCAAGACAGCCGTCTGTGACATCCCACCTCGTGGCCTCAAGATGGCAGTCACCTTCATTGGCAATAGCACAGCCATCCAGGAGCTCTTCAAGCGCATCTCGGAGCAGTTCACTGCCATGTTCCGCCGGAAGGCCTTCCTCCACTGGTACACAGGCGAGGGCATGGACGAGATGGAG