Transcript asmbl_147893

Sequence
Transcript Sequence for observation asmbl_147893 of TGE0058082:
CCAGCCTGCTTTCCCTCCGCGCCCTCCCCTCTCCTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACCTGCGGAGAAAAAAAATTACTTATTTTCTTGCCCCATACATACCTTGAGGCGAGCAAAAAAATTAAATTTTAACCATGAGGGAAATCGTGCACATCCAGGCTGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGATCAGTGATGAACATGGCATCGACCCCACCGGCACCTACCACGGGGACAGCGACCTGCAGCTGGACCGCATCTCTGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCCATCCTGGTGGATCTAGAACCTGGGACCATGGACTCTGTTCGCTCAGGTCCTTTTGGCCAGATCTTTAGACCAGACAACTTTGTATTTGGTCAGTCTGGGGCAGGTAACAACTGGGCCAAAGGCCACTACACAGAGGGCGCCGAGCTGGTTGATTCTGTCCTGGATGTGGTACGGAAGGAGGCAGAGAGCTGTGACTGCCTGCAGGGCTTCCAGCTGACCCACTCACTGGGCGGGGGCACAGGCTCTGGAATGGGCACTCTCCTTATCAGCAAGATCCGAGAAGAATACCCTGATCGCATCATGAATACCTTCAGTGTGGTGCCTTCACCCAAAGTGTCTGACACCGTGGTCGAGCCCTACAATGCCACCCTCTCCGTCCATCAGTTGGTAGAGAATACTGATGAGACCTATTGCATTGACAACGAGGCCCTCTATGATATCTGCTTCCGCACTCTGAAGCTGACCACACCAACCTACGGGGATCTGAACCACCTTGTCTCAGCCACCATGAGTGGTGTCACCACCTGCCTCCGTTTCCCTGGCCAGCTCAATGCTGACCTCCGCAAGTTGGCAGTCAACATGGTCCCCTTCCCACGTCTCCATTTCTTTATGCCTGGCTTTGCCCCTCTCACCAGCCGTGGAAGCCAGCAGTATCGAGCTCTCACAGTGCCGGAACTCACCCAGCAGGTCTTCGATGCCAAGAACATGATGGCTGCCTGTGACCCCCGCCACGGCCGATACCTCACCGTGGCTGCTGTCTTCCGTGGTCGGATGTCCATGAAGGAGGTCGATGAGCAGATGCTTAACGTGCAGAACAAGAACAGCAGCTACTTTGTGGAATGGATCCCCAACAATGTCAAGACAGCCGTCTGTGACATCCCACCTCGTGGCCTCAAGATGGCAGTCACCTTCATTGGCAATAGCACAGCCATCCAGGAGCTCTTCAAGCGCATCTCGGAGCAGTTCACTGCCATGTTCCGCCGGAAGGCCTTCCTCCACTGGTACACAGGCGAGGGCATGGACGAGATGGAG