Transcript asmbl_142667

Sequence
Transcript Sequence for observation asmbl_142667 of TGE0031172:
CAAAATTCCGTACCTACCAAAACCACTCCTCAGTGTTACCACTCTTCAGCTGAGAAAGTAGGGTGGCCCTGAAAAGGGCCTTTTATTGATAGAAAGGGACGCTCAACCACCGAAACCGTAGAGGGTGCGGCCCTGGCGCTTGAGCGCGTAGACCACATCCATGGCGGTGACCGTCTTGCGCTTGGCGTGCTCTGTATAGGTCACGGCGTCCCGGATCACGTTCTCCAGGAACACCTTCAGCACCCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATGCGCTTCACGCCGCCGCGGCGAGCAAGGCGCCGGATGGCCGGCTTGGTGATGCCCTGGATATTGTCGCGCAGTACTTTACGGTGGCGCTTAGCGCCGCCTTTGCCAAGACCCTTCCCGCCTTTGCCGCGGCCAGACATGACGAGCAAGAGGAGTCTCACCCAACGCTTTGTGAGGCCTCTGGCCTGAGGCAGCGCCTTTATACGACAGTTGGCGGACCGAACTGAGAACCTGAAAGAAGTCGGCGGGAAGTCCCGCCCCGGTGGGGGAGGGGAAATCTAAAGGGCCAAACCGAAATAGGGG