Transcript asmbl_138778

Sequence
Transcript Sequence for observation asmbl_138778 of TGE0058072:
CGGCCATGTTGGGGAGTGCGGCGCCGCGGCCCGCGCCACCTCCGCCCCCCGCGGCTTGCCTCCAGCCCGCCCCTCCCGGCCCTCCTCCCCCCGCCCGCCGCTCCGTGCAGCCTGAGAGGAAACAAAGTGCTGCGAGCAGGAGACGGCGGCGGCGCGAACCCTGCTGGGCCTCCAGTCACCCTCGTCTTGCATTTTCCCGCGTGCGTGTGTGAGTGGGTGTGTGTGTTTTCTTACAAAGGGTATTTCGCGATCGATCGATTGATTCGTAGTTCCCCCCCGCGCGCCTTTGCCCTTTGTGCTGTAATCGAGCTCCCGCCATCCCAGGTGCTTCTCCGTTCCTCTAAACGCCAGCGTCTGGACGTGAGCGCAGGTCGCCGGTTTGTGCCTTCGGTCCCCGCTTCGCCCCCTGCCGTCCCCTCCTTATCACGGTCCCGCTCGCGGCCTCGCCGCCCCGCTGTCTCCGCCGCCCGCCATGGCGACTGCGACCCCCGTGCCGCCGCGGATGGGCAGCCGCGCTGGCGGCCCCACCACGCCGCTGAGCCCCACGCGCCTGTCGCGGCTCCAGGAGAAGGAGGAGCTGCGCGAGCTCAATGACCGGCTGGCGGTGTACATCGACAAGGTGCGCAGCCTGGAGACGGAGAACAGCGCGCTGCAGCTGCAGGTGACGGAGCGCGAGGAGGTGCGCGGCCGTGAGCTCACCGGCCTCAAGGCGCTCTACGAGACCGAGCTGGCCGACGCGCGACGCGCGCTCGACGACACGGCCCGCGAGCGCGCCAAGCTGCAGATCGAGCTGGGCAAGTGCAAGGCGGAACACGACCAGCTGCTCCTCAACTATGCTAAGAAGGAATCTGATCTTAATGGCGCCCAGATCAAGCTTCGAGAATATGAAGCAGCACTGAATTCGAAAGATGCAGCTCTTGCTACTGCACTTGGTGACAAAAAAAGTTTAGAGGGAGATTTGGAGGATCTGAAGGATCAGATTGCCCAGTTGGAAGCCTCCTTAGCTGCAGCCAAAAAACAGTTAGCAGATGAAACTTTACTTAAAGTAGATTTGGAGAATCGTTGTCAGAGCCTTACTGAGGACTTGGAGTTTCGCAAAAGCATGTATGAAGAGATTTTGTCAAGTGCATGCTCCTGTGTAGTAGTTAAGAG