Transcript asmbl_138623

Sequence
Transcript Sequence for observation asmbl_138623 of TGE0058071:
ACTCAGGAGCACTTAACAAACACTGGGCATACAAGTTTTTATTAGTGACTTGTCTAATCAACTCTTTGAAATTATTTTTCTAGCTAAAGAGGCTACAACCATCGATTTGAGTATCCTCGCAGAAACTGCATCACCCAGTTTATCCAAAGAACCACAAATGGTTTCTGATAGAACTACACCAATCATCCCTTTAGTTGATGAATTACCTGTCATTCCAACAGAGTTCCCTCCCGTGGGAAATATTGTCAGTTTTGAACAGAAAGCCACAGTCCAACCTCAGGCTATCACAGATAGTTTAGCCACCAAATTACCCACACCTACTGGCAGTACCAAGAAGCCCTGGGATATGGATGACTACTCACCTTCTGCTTCAGGACCTCTTGGAAAGCTAGACATATCAGAAATTAAGGAAGAAGTGCTCCAGAGTACAACTGGCGTCTCTCATTATGCTACGGATTCATGGGATGGTGTCGTGGAAGATAAACAAACACAAGAATCGGTTACACAGATTGAACAAATAGAAGTGGGTCCTTTGGTAACATCTATGGAAATCTTAAAGCACATTCCTTCCAAGGAATTCCCTGTAACTGAAACACCATTGGTAACTGCAAGAATGATCCTGGAATCCAAAACTGAAAAGAAAATGGTAAGCACTGTTTCTGAATTGGTAACCACAGGTCACTATGGATTCACCTTGGGAGAAGAGGATGATGAAGACAGAACACTTACAGTTGGATCTGATGAGAGCACCTTGATCTTTGACCAAATTCCTGAAGTCATTACGGTGTCAAAGACTTCAGAAGACACCATCCACACTCATTTAGAAGACTTGGAGTCAGTCTCAGCATCCACAACTGTTTCCCCTTTAATTATGCCTGATAATAATGGATCATCCATGGATGACTGGGAAGAGAGACAAACTAGTGGTAGGATAACGGAAGAGTTTCTTGGCAAATATCTGTCTACTACACCTTTTCCATCACAGCATCGTACAGAAATAGAATTGTTTCCTTATTCTGGTGATAAAATATTAGTAGAGGGAATTTCCACAGTTATTTATCCTTCTCTACAAACAGAAATGACACATAGAAGAGAAAGAACAGAAACACTAATACCAGAGATGAGAACAGATACTTATACAGATGAAATACAAGAAGAGATCACTAAAAGTCCATTTATGGGAAAAACAGAAGAAGAAGTCTTCTCTGGGATGAAACTCTCTACATCTCTCTCAGAGCCAATTCATGTTACAGAGTCTTCTGTGGAAATGACCAAGTCTTTTGATTTCCCAACATTGATAACAAAGTTAAGTGCAGAGCCAACAGAAGTAAGAGATATGGAGGAAGACTTTACAGCAACTCCAGGTACTACAAAATATGATGAAAATATTACAACAGTGCTTTTGGCCCATGGTACTTTAAGTGTTGAAGCAGCCACTGTATCAAAATGGTCATGGGATGAAGATAATACAACATCCAAGCCTTTAGAGTCTACAGAACCTTCAGCCTCTTCAAAATTGCCCCCTGCCTTACTCACAACTGTGGGGATGAATGGAAAGGATAAAGACATCCCAAGTTTCACTGAAGATGGAGCAGATGAATTTACTCTTATTCCAGATAGTACTCAAAAGCAGTTAGAGGAGGTTACTGATGAAGACATAGCAGCCCATGGAAAATTCACAATTAGATTTCAGCCAACTACATCAACTGGTATTGCAGAAAAGTCAACTTTGAGAGATTCTACAACTGAAGAAAAAGTTCCACCTATCACAAGCACTGAAGGCCAAGTTTATGCAACCATGGAAGGAAGTGCTTTGGGTGAAGTAGAAGATGTGGACCTCTCTAAGCCAGTATCTACTGTTCCCCAATTTGCACACACTTCAGAGGTGGAAGGATTAGCATTTGTTAGTTATAGTAGCACCCAAGAGCCTACTACTTATGTAGACTCTTCCCATACCATTCCTCTTTCTGTAATTCCCAAGACAGACTGGGGAGTGTTAGTACCTTCTGTTCCATCAGAAGATGAAGTTCTAGGTGAACCCTCTCAAGACATACTTGTCATTGATCAGACTCGCCTTGAAGCGACTATTTCTCCAGAAACTATGAGAACAACAAAAATCACAGAGGGAACAACTCAGGAAGAATTCCCTTGGAAAGAACAGACTGCAGAGAAACCAGTTCCTGCTCTCAGTTCTACAGCTTGGACTCCCAAGGAGGCAGTAACACCACTGGATGAACAAGAGGGCGATGGATCAGCATATACAGTCTCTGAAGATGAATTGTTGACAGGTTCTGAGAGGGTCCCAGTTTTAGAAACAACTCCAGTTGGAAAAATTGATCACAGTGTGTCTTATCCACCAGGTGCTGTAACTGAGCACAAAGTGAAAACAGATGAAGTGGTAACACTAACACCACGCATTGGGCCAAAAGTATCTTTAAGTCCAGGGCCTGAACAAAAATATGAAACAGAAGGTAGTAGTACAACAGGATTTACATCATCTTTGAGTCCTTTTAGTACCCACATTACCCAGCTTATGGAAGAAACCACTACTGAGAAAACATCCCTAGAGGATATTGATTTAGGCTCAGGATTATTTGAAAAGCCCAAAGCCACAGAACTCATAGAATTTTCAACAATCAAAGTCACAGTTCCAAGTGATATTACCACTGCCTTCAGTTCAGTAGACAGACTTCACACAACTTCAGCATTCAAGCCATCTTCCGCGATCACTAAGAAACCACCTCTCATCGACAGGGAACCTGGTGAAGAAACAACCAGTGACATGGTAATCATTGGAGAATCAACATCTCATGTTCCTCCCACTACCCTTGAAGATATTGTAGCCAAGGAAACAGAAACCGATATTGATAGAGAGTATTTCACGACTTCAAGTCCTCCTGCTACACAGCCAACAAGACCACCCACTGTGGAAGACAAAGAGGCCTTTGGACCTCAGGCGCTTTCTACGCCACAGCCCCCAGCAAGCACAAAATTTCACCCTGACATTAATGTTTATATTATTGAGGTCAGAGAAAATAAGACAGGTCGAATGAGTGATTTGAGTGTAATTGGTCATCCAATAGATTCAGAATCTAAAGAAGATGAACCTTGTAGTGAAGAAACAGATCCAGTGCATGATCTAATGGCTGAAATTTTACCTGAATTCCCTGACATAATTGAAATAGACCTATACCACAGTGAAGAAAATGAAGAAGAAGAAGAAGAGTGTGCAAATGCTACTGATGTGACAACCACCCCATCTGTGCAGTACATAAATGGGAAGCATCTCGTTACCACTGTGCCCAAGGACCCAGAAGCTGCAGAAGCTAGGCGTGGCCAGTTTGAAAGTGTTGCACCTTCTCAGAATTTCTCGGACAGCTCTGAAAGTGATACTCATCCATTTGTAATAGCCAAAACGGAATTGTCTACTGCTGTGCAACCTAATGAATCTACAGAAACAACTGAGTCTCTTGAAGTTACATGGAAGCCTGAGACTTACCCTGAAACATCAGAACATTTTTCAGGTGGTGAGCCTGATGTTTTCCCCACAGTCCCATTCCATGAGGAATTTGAAAGTGGAACAGCCAAAAAAGGGGCAGAATCAGTCACAGAGAGAGATACTGAAGTTGGTCATCAGGCACATGAACATACTGAACCTGTATCTCTGTTTCCTGAAGAGTCTTCAGGAGAGATTGCCATTGACCAAGAATCTCAGAAAATAGCCTTTGCAAGGGCTACAGAAGTAACATTTGGTGAAGAGGTAGAAAAAAGTACTTCTGTCACATACACTCCCACTATAGTTCCAAGTTCTGCATCAGCATATGTTTCAGAGGAAGAAGCAGTTACCCTAATAGGAAATCCTTGGCCAGATGACCTGTTGTCTACCAAAGAAAGCTGGGTAGAAGCAACTCCTAGACAAGTTGTAGAGCTCTCAGGGAGTTCTTCGATTCCAATTACAGAAGGCTCTGGAGAAGCAGAAGAAGATGAAGATACAATGTTCACCATGGTAACTGATTTATCACAGAGAAATACTACTGATACACTCATTACTTTAGACACTAGCAGGATAATCACAGAAAGCTTTTTTGAGGTTCCTGCAACCACCATTTATCCAGTTTCTGAACAACCTTCTGCAAAAGTGGTGCCTACCAAGTTTGTAAGTGAAACAGACACTTCTGAGTGGATTTCCAGTACCACTGTTGAGGAAAAGAAAAGGAAGGAGGAGGAGGGAACTACAGGTACGGCTTCTACATTTGAGGTATATTCATCTACACAGAGATCGGATCAATTAATTTTACCCTTTGAATTAGAAAGTCCAAATGTAGCTACATCTAGTGATTCAGGTACCAGGAAAAGTTTTATGTCCTTGACAACACCAACACAGTCTGAAAGGGAAATGACAGATTCTACTCCTGTCTTTACAGAAACAAATACATTAGAAAATTTGGGGGCACAGACCACTGAGCACAGCAGTATCCATCAACCTGGGGTTCAGGAAGGGCTGACCACTCTCCCACGTAGTCCTGCCTCTGTCTTTATGGAGCAGGGCTCTGGAGAAGCTGCTGCCGACCCAGAAACCACCACTGTTTCTTCATTTTCATTAAACGTAGAGTATGCAATTCAAGCCGAAAAGGAAGTAGCTGGCACTTTGTCTCCGCATGTGGAAACTACATTCTCCACTGAGCCAACAGGACTGGTTTTGAGTACAGTAATGGACAGAGTAGTTGCTGAAAATATAACCCAAACATCCAGGGAAATAGTGATTTCAGAGCGATTAGGAGAACCAAATTATGGGGCAGAAATAAGGGGCTTTTCCACAGGTTTTCCTTTGGAGGAAGATTTCAGTGGTGACTTTAGAGAATACTCAACAGTGTCTCATCCCATAGCAAAAGAAGAAACGGTAATGATGGAAGGCTCTGGAGATGCAGCATTTAGGGACACCCAGACTTCACCATCTACAGTACCTACTTCAGTTCACATCAGTCACATATCTGACTCAGAAGGACCCAGTAGCACCATGGTCAGCACTTCAGCCTTCCCCTGGGAAGAGTTTACATCCTCAGCTGAGGGCTCAGGTGAGCAACTGGTCACAGTCAGCAGCTCTGTTGTTCCAGTGCTTCCCAGTGCTGTGCAAAAGTTTTCTGGTACAGCTTCCTCCATTATCGACGAAGGATTGGGAGAAGTGGGTACTGTCAATGAAATTGATAGAAGATCCACCATTTTACCAACAGCAGAAGTGGAAGGTACGAAAGCTCCAGTAGAGAAGGAGGAAGTAAAGGTCAGTGGCACAGTTTCAACAAACTTTCCCCAAACTATAGAGCCAGCCAAATTATGGTCTAGGCAAGAAGTCAACCCTGTAAGACAAGAAATTGAAAGTGAAACAACATCAGAGGAACAAATTCAAGAAGAAAAGTCATTTGAATCCCCTCAAAACTCTCCTGCAACAGAACAAACAATCTTTGATTCACAGACATTTACTGAAACTGAACTCAAAACCACAGATTATTCTGTACTAACAACAAAGAAAACTTACAGTGATGATAAAGAAATGAAGGAGGAAGACACTTCTTTAGTTAACATGTCTACTCCAGATCCAGATGCAAATGGCTTGGAATCTTACACAACTCTCCCTGAAGCTACTGAAAAGTCACATTTTTTCTTAGCTACTGCATTAGTAACTGAATCTATACCAGCTGAACATGTAGTCACAGATTCACCAATCAAAAAGGAAGAAAGTACAAAACATTTTCCGAAAGGCATGAGACCAACAATTCAAGAGTCAGATACTGAGCTCTTATTCTCTGGACTGGGATCAGGAGAAGAAGTTTTACCTACTCTACCAACAGAGTCAGTGAATTTTACTGAAGTGGAACAAATCAATAACACATTATATCCCCACACTTCTCAAGTGGAAAGTACCTCAAGTGACAAAATTGAAGACTTTAACAGAATGGAAAATGTGGCAAAAGAAGTTGGACCACTCGTATCTCAAACAGACATCTTTGAAGGTAGTGGGTCAGTAACCAGCACAACATTAATAGAAATTTTAAGTGACACTGGAGCAGAAGGACCCACGGTGGCACCTCTCCCTTTCTCCACGGACATCGGACATCCTCAAAATCAGACTGTCAGGTGGGCAGAAGAAATCCAGACTAGTAGACCACAAACCATAACTGAACAAGACTCTAACAAGAATTCTTCAACAGCAGAAATTAACGAAACAACAACCTCATCTACTGATTTTCTGGCTAGAGCTTATGGTTTTGAAATGGCCAAAGAATTTGTTACATCAGCACCAAAACCATCTGACTTGTATTATGAACCTTCTGGAGAAGGATCTGGAGAAGTGGATATTGTTGATTCATTTCACACTTCTGCAACTACTCAGGCAACCAGACAAGAAAGCAGCACCACATTTGTTTCTGATGGGTCCCTGGAAAAACATCCTGAGGTGCCAAGCGCTAAAGCTGTTACTGCTGATGGATTCCCAACAGTTTCAGTGATGCTGCCTCTTCATTCAGAGCAGAACAAAAGCTCCCCTGATCCAACTAGCACACTGTCAAATACAGTGTCATATGAGAGGTCCACAGACGGTAGTTTCCAAGACCGTTTCAGGGAATTCGAGGATTCCACCTTAAAACCTAACAGAAAAAAACCCACTGAAAATATTATCATAGACCTGGACAAAGAGGACAAGGATTTAATATTGACAATTACAGAGAGTACCATCCTTGAAATTCTACCTGAGCTGACATCGGATAAAAATACTATCATAGATATTGATCATACTAAACCTGTGTATGAAGACATTCTTGGAATGCAAACAGATATAGATACAGAGGTACCATCAGAACCACATGACAGTAATGATGAAAGTAATGATGACAGCACTCAAGTTCAAGAGATCTATGAGGCAGCTGTCAACCTTTCTTTAACTGAGGAAACATTTGAGGGCTCTGCTGATGTTCTGGCTAGCTACACTCAGGCAACACATGATGAATCAATGACTTATGAAGATAGAAGCCAACTAGATCACATGGGCTTTCACTTCACAACTGGGATCCCTGCTCCTAGCACAGAAACAGAATTAGACGTTTTACTTCCCACGGCAACATCCCTGCCAATTCCTCGTAAGTCTGCCACAGTTATTCCAGAGATTGAAGGAATAAAAGCTGAAGCAAAAGCCCTGGATGACATGTTTGAATCAAGCACTTTGTCTGATGGTCAAGCTATTGCAGACCAAAGTGAAATAATACCAACATTGGGCCAATTTGAAAGGACTCAGGAGGAGTATGAAGACAAAAAACATGCTGGTCCTTCTTTTCAGCCAGAATTCTCTTCAGGAGCTGAGGAGGCATTAGTAGACCATACTCCCTATCTAAGTATTGCTACTACCCACCTTATGGATCAGAGTGTAACAGAGGTGCCTGATGTGATGGAAGGATCCAATCCCCCATATTACACTGATACAACATTAGCAGTTTCAACATTTGCGAAGTTGTCTTCTCAGACACCATCATCTCCCCTCACTATCTACTCAGGCAGTGAAGCCTCTGGACACACAGAGATCCCCCAGCCCAGTGCTCTGCCAGGAATAGACGTCGGCTCATCTGTAATGTCCCCACAGGATTCTTTTAAGGAAATTCATGTAAATATTGAAGCGACTTTCAAACCATCAAGTGAGGAATACCTTCACATAACTGAGCCTCCCTCTTTATCTCCTGACACAAAATTAGAACCTTCAGAAGATGATGGTAAACCTGAGTTATTAGAAGAAATGGAAGCTTCTCCCACAGAACTTATTGCTGTGGAAGGAACTGAGATTCTCCAAGATTTCCAAAACAAAACCGATGGTCAAGTTTCTGGAGAAGCAATCAAGATGTTTCCCACCATTAAAACACCTGAGGCTGGAACTGTTATTACAACTGCCGATGAAATTGAATTAGAAGGTGCTACACAGTGGCCACACTCTACTTCTGCTTCTGCCACCTATGGGGTCGAGGCAGGTGTGGTGCCTTGGCTAAGTCCACAGACTTCTGAGAGGCCCACGCTTTCTTCTTCTCCAGAAATAAACCCTGAAACTCAAGCAGCTTTAATCAGAGGGCAGGATTCCACGATAGCAGCATCAGAACAGCAAGTGGCAGCGAGAATTCTTGATTCCAATGATCAGGCAACAGTAAACCCTGTGGAATTTAATACTGAGGTTGCAACACCACCATTTTCCCTTCTGGAGACTTCTAATGAAACAGATTTCCTGATTGGCATTAATGAAGAGTCAGTGGAAGGCACGGCAATCTATTTACCAGGACCTGATCGCTGCAAAATGAACCCGTGCCTTAACGGAGGCACCTGTTATCCTACTGAAACTTCCTACGTATGCACCTGTGTGCCAGGATACAGCGGAGACCAGTGTGAACTTGATTTTGATGAATGTCACTCTAATCCCTGTCGTAATGGAGCCACTTGTGTTGATGGTTTTAACACATTCAGGTGCCTCTGCCTTCCAAGTTATGTTGGTGCACTTTGTGAGCAAGATACCGAGACATGTGACTATGGCTGGCACAAATTCCAAGGGCAGTGCTACAAATACTTTGCCCATCGACGCACATGGGATGCAGCTGAACGGGAATGCCGTCTGCAGGGTGCCCATCTCACAAGCATCCTGTCTCACGAAGAACAAATGTTTGTTAATCGTGTGGGCCATGATTATCAGTGGATAGGCCTCAATGACAAGATGTTTGAGCATGACTTCCGTTGGACTGATGGCAGCACACTGCAATACGAGAATTGGAGACCCAACCAGCCAGACAGCTTCTTTTCTGCTGGAGAAGACTGTGTTGTAATCATTTGGCATGAGAATGGCCAGTGGAATGATGTTCCCTGCAATTACCATCTCACCTATACGTGCAAGAAAGGAACAGTCGCTTGCGGCCAGCCCCCTGTTGTAGAAAATGCCAAGACCTTTGGAAAGATGAAACCTCGTTATGAAATCAACTCCCTGATTAGATACCACTGCAAAGATGGTTTCATTCAACGTCACCTTCCAACTATCCGGTGCTTAGGAAATGGAAGATGGGCTATACCTAAAATTACCTGCATGAACCGTAAGTGGTCCTTTAGAAAGAATGGACTACCGTGCTATAACAACTACTAGACACCTTCATTTTACGGCTGTGGTATCGGCAGTTTAGGGTATGGAGCAAGTAATATTGTGTGTTTTCTTTTTTTCTTTCTTTCCTTCCATGTAGCATCTGCATACCAAAGGACTTATTCTATGAAATACTTTAAAAATTCCTCATCAGCAAAGGACAATTCAATAAATACATCCAAACATGATCATCGTTGGAGCCGGAGGTGGCAGGAGTCGAGGCGCTGATCCCTAAAATGGCGAACATGTGTTTTCATCATTTCAGCCAAAGTCCTAACTTCCTGTGCCTTTCCTATCACCTCGAGAAGTAATTATCAGTTGGTTTGGATTTTTGGACCACCGTTCAGTCATTTTGGGTTGCCGTGCTCCCAAAACATTTTAAATGAAAGTATTGGCATTCAAAAAGACAGCAGACAAAATGAAAGAAAATGAGAGCAGAAAGTAAGCATTTCCAGCCTATCTAATTTCTTTAGTTTTCTATTTGCCTCCAGTGCAGTCCATTTCCTAATGTATACCAGCCTACTGTACTATTTAAAATGCTCAATTTCAGCACCGATGGCCATGTAAATAAGATGATTTAATGTTGATTTTAATCCTGTATATAAAATAAAAAGTCACAATGAGTTTGGGCATATTTAATGATGATTATGGAGCCTTAGAGGTCTTTAATCATTGGTTCGGCTGCTTTTATGTAGTTTAGGCTGGAAATGGTTTCACTTGCTCTTTGACTGTCAGCAAGACTGAAGATGGCTTTTCCTGGACAGCTAGAAAACACAAAATCTTGTAGGTCATTGCACCTATCTCAGCCATAGGTGCAGTTTGCTTCTACATGATGCTAAAGGCTGCGAATGGGATCCTGATGGAACTAAGGACTCCAATGTCGAACTCTTCTTTGCTGCATTCCTTTTTCTTCACTTACAAGAAAGGCCTGAATGGAGGACTTTTCTGTAACCAGGAACATTTTTTAGGGGTCAAAGTGCTAATAATTAACTCAACCAGGTCTACTTTTTAATGGCTTTCATAACACTAACTCATAAGGTTACCGATCAATGCATTTCATACGGATATAGACCTAGGGCTCTGGAGGGTGGGGGATTGTTAAAACACATGC