Transcript asmbl_132982

Sequence
Transcript Sequence for observation asmbl_132982 of TGE0002156:
CCGGGTAGGATTGTGAGTCTGTCGTAAATTTGAGTTTGTATGTGTTAGTTGTAAATCAGGACTTGGCTTTGAGATGAATCCACCTGGGTCAGCTGGGTTTTTGTGCACGAGGGACGTCAGAAAGCTTTGTGTTTGTGAGGCAAACTAGGGAGTTAGTGTGGGTGAAGCAGTCAAGTGCTGGAGTGTGAACATTTCTAAGACGTCTAAATTGCGCGAAAGTGTGTGAGGCAAGGCTGTTGCGCGAGCGGGCAGTGTGCGCCTGTGTGTGCGTGTGCGCGCGCGCCAAGTTTGGTTTGTGATTGTGATGGGCACCGACGCTGCGTCAGCCCGGGAGGCCACGTTAGGGTTGGGGGTGCGTGAGGAGGTGCGGCCGGGCGAGAGGTCCAGCGAGTGAGCCAAGCGCGGCGCTACTCTGGGCCCCTGCTCCGCGCGCTAGCTGGCTGTGTGGCTCGCTGGCTCGCTAGGGACAAGCAGGAATCGGAGCAGCACTGCCGCCTCTGGCGCGAAGGCTCAGGCGCCTCCTCCCGCCACAGTCACTGTGGCTCGGCGCACGCTGCCGGCGGCTGCCCTTTCCGCCTCTGGGGAAGAAAAACCCGCGGGCCGCTTTCGTGCTTGAACCATGGCCTCGGGCCGGAGGGGCTGGGACAGCTCCCACGAAGACGATCTGCCCGTGTACCTGGCCAGGCCGGGCACCACGGACCAGGTCCCGCGGCAGAAATACGGCGGCATGTTCTGCAACGTGGAGGGCGCCTTCGAGAGCAAGACGCTGGATTTCGATGCCCTCAGCGTGGGGCAGCGGGGCGCGAAGACTCCTCGGAGCGGCCAGGGCAGCGACCGAGGATCGGGGAGTCGGCCCGGGATCGAGGGGGACACCCCGCGCAGGGGCCAAGGCCGGGAAGAGAGCAGGGAGCCCGCGCCCGCCTCCCCCGCCCCCGCCGGGGTAGAGATCCGGAGCGCCACCGGCAAAGAGGTGTTGCAGAACCTCGGCCCCAAGGACAAGAGTGACCGTCTCCTTATCAAGGGAGGCAGAATCGTCAATGATGATCAGTCCTTTTATGCTGATATTTACATGGAAGATGGCTTAATAAAACAAATTGGAGACAATCTGATTGTTCCTGGAGGAGTGAAGACCATTGAAGCCAATGGGAAGATGGTGATCCCTGGAGGCATCGATGTCCATACTCACTTCCAGATGCCATATAAGGGAATGACCACAGTAGATGACTTCTTCCAAGGGACAAAGGCGGCCTTAGCAGGTGGCACCACCATGATCATTGACCATGTGGTGCCTGAGCCTGAGTCCAGCCTGACTGAGGCCTATGAGAAATGGAGAGAGTGGGCTGATGGGAAGAGTTGCTGTGACTATGCCCTGCATGTGGACATCACCCACTGGAATGACAGCGTCAAGCAGGAAGTGCAGAACCTCATCAAGGACAAAGGGGTTAACTCCTTCATGGTTTATATGGCTTATAAGGATTTGTATCAAGTATCTAACACAGAGCTCTATGAGATCTTCACCTGCCTGGGAGAGCTGGGGGCCATTGCTCAAGTTCATGCTGAGAATGGGGATATCATTGCCCAGGAGCAAACCCGCATGTTGGAAATGGGGATAACTGGCCCAGAAGGCCATGTACTGAGCAGGCCAGAAGAGCTGGAAGCTGAGGCTGTGTTCCGTGCCATCACCATTGCCAGCCAAACCAATTGCCCTCTCTACGTCACAAAGGTCATGAGCAAGAGTGCAGCTGACCTCATCTCACAAGCCAGGAAAAAAGGAAATGTAGTCTTTGGTGAGCCCATCACTGCCAGCCTCGGCATAGATGGAACCCATTATTGGAGCAAGAACTGGGCCAAGGCGGCTGCATTTGTGACATCCCCACCCCTGAGCCCTGACCCAACTACTCCGGACTACATCAACTCCTTGCTGGCCAGCGGGGATCTGCAGCTATCTGGGAGTGCCCACTGCACCTTCAGCACTGCCCAGAAAGCAATTGGGAAGGACAACTTCACAGCCATTCCTGAGGGCACCAATGGTGTGGAGGAGCGGATGTCTGTCATCTGGGACAAGGCTGTGGCCACAGGGAAAATGGACGAAAACCAGTTCGTGGCTGTGACAAGCACAAACGCTGCCAAGATCTTCAACCTGTATCCCCGCAAGGGAAGAATATCTGTGGGTTCTGACAGCGACCTCGTCATCTGGGATCCAGATGCTGTGAAGATCGTCTCTGCCAAGAACCACCAGTCTGCGGCAGAGTACAACATCTTTGAAGGGATGGAGCTGCGCGGGGCTCCTCTGGTTGTCATCTGCCAGGGCAAGATCATGCTGGAAGATGGCAACCTGCACGTGACCCAGGGGGCTGGCCGCTTCATACCCTGCAGCCCGTTCTCCGACTATGTCTACAAGCGCATTAAAGCACGGAGGAAGATGGCAGACCTGCATGCCGTCCCAAGGGGCATGTACGATGGGCCTGTGTTTGACCTGACCACCACCCCCAAAGGTGGCACCCCCGCAGGCTCTGCTCGGGGCTCTCCTACTCGGCCGAACCCACCTGTGAGGAATCTTCATCAGTCGGGATTTAGCCTGTCAGGCACCCAAGTGGATGAGGGGGTTCGCTCAGCCAGCAAGCGCATCGTGGCGCCCCCAGGCGGCCGTTCTAATATCACATCTCTGAGTTAAGCAAGCCTTCCTCAAAGAGAGGGGCAGAAGCAAGAAGAGATTGTTTTGAAGCCAAAATGGTACACCGATATTTAAGAAGGAAAGCGAATCCAAACGGTTGTGATCTAAAGAATCAATAAGCCTCAAGCCTTATGTTTCTCCAATGTTACGCTCGCTTGCCTAGCTTTACGAATATTGCTTTGTTTTCTGTTTATGCATAGCCTTGATTTGTTTGACTCCCCTCCCCCCATTTACATGCATGCAATCAGACAGGCCACTAAGGTAAAAGAGTCTGCTCTATCATAGTGTTGAGAGCGTGTGTAGTGCTGCATCTTATGACAAGGGGACAGACAAGCTGGGACGTCAGGGAAATGAACAAAAGGGACGCAGGTTATTTGGGGTGAGTGGGTGGTGGGAGCCTGGAGCAAGGTGGAGGGTGCAGAGGGGCTGGGGTAGGGCATGTAGGAGGGAGGTGGGTGGGTCAGGTGAGTGGAAGGGGTGTTGTATATTGTGTTGATGACGTACGTTATTTCCATGGAAGATAGCCGCTGTGGCAGCTGTCACATCACCACAGCTCCCTAGGGTCTGCCGAGAAGGCAGGCAGTCTTTGGGTTCTGTTCTTTGTCACGTCCCCTACAAGTAAATTTTGTTTCTTTGAACGTTTATTAAAATGCCAAGACCCAACCATTTCTTCCACCTGCTTGATTGTGCCAGTGTTTGCTCAGGCCTCTTTCTTAGTGTTGCTTTCAAATCCTTCTCTTTCCTGGGTTGGGAAGGCCAGGCAGGGACAGAGCAAATGACACTTCTCTTCCTCTTGCCCTCCCTGCCTCTTTGGTGCTCTTAAAAGCCAGCAGCTGAGAACATAGCACAGGCCCACGTGGTGAGGGCACCCACAGCTTAAAGACGCTTCCTTCTAAACACGGCGAGGTCACCTCTCACTCTTCTGTCTTTGCAAACCGAGAAGAGTGGCATGCTTCTGGCATCCCAAGTCAGGATTTTAGCTCAGATGAGGCAGAATGAAGGGCCTCTCTTACAGGCAGTTTGTGTTTGATTCTCTCGATCCTGGCACATCCATGATAAATAGGAGTTTTTGAAAGTTGGTTTTATTAGGTGTTCCCTAATTTTTACCGTAATAGGTCATCTCAGCTTATATGAAAGTCAAGTGGGGAACTGGGAAAGCCAAAGTCAGTCTTGAGCAGAGGGAGCACATTTTGTGGACCTGGTTCCACCTTTCCATTCCAAACCACCTGTTTCCCCTTCCATTAGCAGAAACTCTGGGGGAACTTTGTGTCTCAGTCCTAGAATCTCCCCAAGTGAGTGGAAGTGACATGATGCAGTCTTCCTCATGGGGCACCTGAAAGAAATTAGTGTGGGTGCTTCGATCTACCTTGTCTGTCAGAGTTGAATATCTCTTTCCCTATCATGCTGCTTCTGAAAATTCAGTTTTGGAGCAAGTCCTGTGAGCAAGATAAGAATCTATAGAACCAAGATGCTCATTTTCAGAAGAAATATGTTCAACCTGGGATCAGACTTCCATGCTCTGGGGAATCCAAGTGGTAGCACCTGTAACCCTGTGTACTAAGTGCTTTGAAGAGAAGAGCAGGCCTCAGACACCTTTTAATTGCTTAGGAGAAACCATTGTCTCTGACTGCAGGTTTGAATAAGTTGAAGACCAGAGAAAAGTACACACTGGGCTACAAAGGAATTTGGAGATAGCCAAGGAACAGGATTTCCCCTAGCAAGCTACCTTCTGTTCAAATCATGAAAAAAGACTATTTCCCCTTAGAATAGGGAAGCTTGCTATTTTAAAGCTCTTGTAGTGCTTTTCTTTTAAGGGAGATGTAGTAAAAGGGAAAATGTAGCTCTTAGTTTACACTTCAAAGATGTGGGGGTCTTTCAGAGAACTAAGAATAACAGTTTTATGTGCAGAGAGAGTTTGCCAGATCTGAAGCATATACCTCATTGACTAGGCTGTTACTTTGGGATAGGTTGCAGTACCAGCCACAGCCAGCAGATAGAGGAAAAGACACACATAAACTCGCTTCTGAGCGTCCACTTCTGCACTCTCTGCTCTGCTGTTACTCAGCCCCTGAGTCTGACTCATCTCTGCACAACCTCTCTGTGCCATGAAGATAAGTCTTCCATGGCCAAATCGGTCATCCGCACTGCCCTTGGGACTTCCGAAGTGAACCATTCCACCAGAACCTTTGATTCTGCACAAGATTTCCTTGCTCTGGGAACAACCCCCAAATGCCCTTGGGAGGAACAACATGAGCTCAGGAAGCCTCTCTTTCTTCACTTACCATTACTAACTCTCCAAGCATAGAAATCCCTGGGAATTGCGAGAATAACTCCCACTATTTTAAAATTTATATTCAGATTTGTTTCGTTTCATAAGACACATCAAACAGGCCTATACAAAAGGTTTAGGAAAAGAAAACAATGGTGAGTCCCGGCCCTCTTCGAATTCACTGGCACCTCATGCAAGTGTAGGAAGGCACGCTGGATCGTCTATCTGATTCCAAAGCTGTCCTTTGCCATCTCATCCCTTGGCCTGCCCCCCAACCCTGAGGATGCCCCTGCCATCCCCCCAACCTCCTCATATTGCCTCTGAACCCAGATGGCAATCCATCCCGGTTCTCTCTGAGGGCCACGGGCTTGGGTAGTGGAAAGGGTGTTTGGGAAATTGTTAAATCAGTTACCCGTAGTAGAGCTATTTCTTGTACTTCTAAGTTTTCTAGAAGTGGAAGGATTGTAGTCATCCTGAAAATGGGTTTACTTCAAAATCCCTCAGCCTTGTTCTTCACGACTGTCTATACTGAGAGTGTCATGTTTCCACAAAGGGCTGACACCTGAGCCTGGATTTTCACTCATCCCTGAGAAGCCCTTTCCAGTAGGGTGGGCAATTCCCAACTTCCTTGCCACAAGCTTCCCAGGCTTTCTCCCCTGGAAAACTCCAGCTTGAGTCCCAGATACACTCATGGGCTGCCCTGGGCAGCCAGCATTCATTGTAAGTTCCCTCTTTGAAAACTGGTGTGTGGGTGTTCAGTTCTGTGTCTGGTGGGTATGGACAGACAGTAATCTCCTGTGATCTGTGCTAGCTGTGAGGCAGCTCTGGAACGTGAAGAGCTGTTTGGTTTGAACCGTGAACAAAACTGTGTTTTGAGTTTAGCTGACATTAAAGAAAAAAGTTCATCACGTGACTGTTAATGTAAACCTGGTTATTAAAATAACTATGAAATTACCA