Transcript asmbl_21916

Sequence
Transcript Sequence for observation asmbl_21916 of TGE0004192:
GTTCGGTTGCGCTGCGGAGCGCAGCTGTGAGGGAGTCTGTCTGGTCCGCGGCCCCAGAACCCGAGCTGAAGCGGTAGCGCAGGCTGCGGGAAGCTGAGTCGGAAGGCCTGAGTGTTTGTTCAAGCATGTCGGAAGGGGAGTCCCAGACAGTACTCAGCAGTGGCTCAGACACAAAGGTAGAATCCTCATCTTCAGCTCCTGGCCTGACATCAGTGTCACCTCCTGTGACCTCCACAACCTCAGCTGCTTCCCCAGAGGAAGAAGAAGAAAGTGAAGATGAGTCTGAGATCTTGGAAGAGTCACCCTGTGGGCGCTGGCAGAAGAGGCGAGAAGAGGTAAATCAGCGGAATGTACCAGGTATTGACAGTGCATACCTGGCCATGGATACAGAGGAGGGTGTAGAGGTTGTGTGGAATGAGGTACAATTCTCTGAGCGCAAGAACTACAAGCTGCAGGAGGAAAAGGTCCGTGCTGTATTCGATAATCTGATTCAATTGGAACATCTCAACATTGTTAAGTTTCACAAATATTGGGCTGACATTAAAGAGAACAAGGCCAGGGTCATTTTTATCACAGAATACATGTCATCTGGGAGTCTTAAGCAATTTTTGAAGAAGACCAAAAAAAACCACAAGACTATGAATGAAAAGGCTTGGAAGCGCTGGTGCACACAGATCCTCTCTGCCCTAAGCTACCTGCACTCCTGTGACCCCCCCATCATCCATGGGAACCTGACCTGTGACACCATCTTCATCCAGCACAACGGACTCATCAAGATTGGCTCTGTGGCTCCTGACACTATCAACAATCATGTGAAGACTTGTCGGGAAGAACAGAAGAATCTACACTTCTTTGCACCAGAGTATGGAGAAGTCACTAATGTGACAACGGCAGTGGACATCTATTCCTTTGGCATGTGTGCACTGGAGATGGCAGTGCTGGAGATTCAGGGCAATGGAGAGTCCTCATATGTGCCACAGGAAGCCATCAGCAGTGCCATCCAGCTTCTAGAAGACCCATTACAGAGGGAGTTCATTCAAAAGTGCCTGCAGTCTGAGCCTGCTCGCAGACCAACAGCCAGAGAACTTCTGTTCCACCCAGCACTGTTTGAAGTGCCCTCACTCAAACTTCTTGCTGCCCACTGCATTGTGGGACACCAACATATGATCCCAGAGAATGCGCTGGAGGAGATCACCAAAAACATGGATACCAGTGCTGTACTGGCTGAAATCCCTGCTGGACCAGGAAGAGAACCAGTTCAGACTTTGTACTCTCAGTCACCAGCTCTGGAATTAGATAAATTCCTTGAAGATGTCAGGAATGGGATCTACCCCCTGACAGCCTTTGGGCTGCCTCGGCCCCAACAGCCACAGCAGGAGGAGGTGACATCACCTGTGGTGCCGCCTTCTGTCAAGACTCCAACACCTGAACCAGCTGAGGTGGAGACCCGAAAGGTGGTGCTGATGCAATGCAACATTGAGTCAGTGGAGGAGGGAGTCAAACACCACCTAACACTTCTGCTGAAGCTGGAGGACAAACTGAACCGGCACCTGAGCTGTGACCTGATGCCAAATGAGAACATCCCTGAGTTGGCAGCTGAGCTGGTGCAGCTGGGCTTCATAAGTGAGGCTGACCAGAGCCGGCTGACTTCTCTGCTAGAAGAGACCCTGAACAAGTTCAATTTTGCCAGGAACAGCACCCTCAACTCAGCCGCTGTCACCGTCTCCTCTTAGAGCTCACTTGGGCCAGGCCTCTAATCTGAGCTGTGGCTGTCACTAGATATGCTGCAGCCTTCCTGCCCCTCCCCCCCAGTCAGTATTACCCTGTGAAGCCCCTTCTCTCCTTTATTATTCAGGAGGGCTTTGGGGCTCCCTGGTTCTGAGCATCACCCTACCCCTTCCCCTTTTATTCCTCCCCTCAGCACTTTGTTTACTTGTTTTGCACAGACGGGGGCCTGGGCCTTCTCAGCAGCCGCCTTCTAGTTGGGGGCTAGTAGCTGATCTGCCGGCTCCTGGCCTGCCTGTGTGGAAAGGGGGCCCACGGGCGCTGGGGGAGCCGAATTCTACAATCCCGCTGGGGCGGACGGGGCG