Transcript asmbl_132848

Sequence
Transcript Sequence for observation asmbl_132848 of TGE0057571:
GCGAGGACTGGTTCCAGTTCACTCGGCAGCGGCGCCGGGCGGAGGGGGAGAGCGCGGGCCGCGCGGGCGGGAAGCGAAGAGGCGGGCGGGCCAGCGAGGAGCGCGGAGAGAAAAGGCGCGAGCGGCCAGGAGGGCTCAGGCCGAGACACCTTGCAGCTGCCGCCGCCGCCACCGAGCCGCCGCTGTGCTCACTGATCCGCCTCCAGGGCCACCGCCATGTCGAGCCGCGGTGGGAAGAAGAAGTCCACCAAGACGTCCAGGTCTGCCAAAGCAGGAGTCATCTTTCCCGTGGGGCGGATGCTGCGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCACCCGTGTACATGGCCGCCGTCCTGGAATACCTGACAGCGGAGATTCTGGAGCTGGCTGGCAATGCAGCGAGAGACAACAAGAAGGGACGGGTCACACCCCGGCACATCCTGCTGGCTGTGGCCAATGATGAAGAGCTGAATCAGCTGCTAAAAGGAGTCACCATAGCCAGTGGGGGTGTGTTACCCAACATCCACCCCGAGTTGCTAGCGAAGAAGCGGGGATCCAAAGGAAAGTTGGAAGCCATCATCACACCACCCCCAGCCAAAAAGGCCAAGTCTCCATCCCAGAAGAAGCCTGTATCTAAAAAAGCAGGAGGCAAGAAAGGGGCCCGGAAATCCAAGAAGCAGGGTGAAGTCAGTAAGGCAGCCAGCGCCGACAGCACAACCGAGGGCACACCTGCCGACGGCTTCACAGTCCTCTCCACCAAGAGCCTCTTCCTTGGCCAGAAGTTGCAAGTTGTACAGGCTGACATTGCCTCGATCGACAGTGATGCTGTCGTTCACCCGACAAACACTGACTTCTACATCGGTGGTGAAGTAGGAAACACGCTGGAGAAGAAAGGTGGCAAGGAGTTTGTGGAAGCTGTCCTGGAACTCCGGAAAAAGAACGGGCCCTTGGAAGTAGCTGGAGCTGCTGTCAGCGCAGGCCATGGCCTGCCTGCCAAGTTTGTGATCCACTGTAATAGTCCAGTTTGGGGTGCAGACAAGTGTGAAGAACTTCTGGAAAAGACAGTGAAAAACTGCTTGGCCCTGGCTGATGATAAGAAGCTGAAATCCATTGCATTTCCATCCATCGGCAGCGGCAGGAACGGTTTTCCAAAGCAGACAGCAGCTCAGCTGATTCTGAAGGCCATCTCCAGTTACTTCGTGTCTACAATGTCCTCTTCCATCAAAACGGTGTACTTCGTGCTTTTTGACAGCGAGAGTATAGGCATCTATGTGCAGGAAATGGCCAAGCTGGACGCCAACTAGGCTGAGCAATGACAGAACCAGCTGCACCATGTACCCCACCTTCAGTTTAAAAGAAAAAAAAAATCCCCTTCACTCCTACTGGGAGGTGGGACCCCTTTCATTTTCAGTTTTGCTCATCTAGGGAAAATAAGGCTTTGGTTTCCAGTTTAATTGTTTTTGACCTTCTAAAATGTTTTTATGTTAGCACTGATAGTTGGCATTACTGTTGTTAAGCACTGTGTTCCAGACCGTGTCTGACTTAGTGTAACCTAGGAGATTTTATAGTTTTATTTTAATGAAACCCTGATTGACGCACAGCAGTGGGGAGAACAGCGTCTTTTACCTGTCACCGAAGCCAGGAAGCCCCGTTTGTAAGCGTGTGTTGTGGTGCTTTATTGTACATCCTCCAGTGGCGTTCTTTTTACTCTAATGTTCTTTTGGTTTCCCCCCTCAGAAGAATCATGAATTTGCAACAGACCTAATTTTTGGTTACTTTTTGTCTTATTGATGGATTTGAAAATGAAAGATTTAATAAGGCAAAGCAGAATCTGTTGTCCTTAATTATATTTGCAATTTGGAATTTGTGTGAGTTGATTTAGTAAAATGTTAAACCGTT