Transcript asmbl_112554

Sequence
Transcript Sequence for observation asmbl_112554 of TGE0015877:
AGCCGACTCAGCGGCGGCCGCCATTTTGTGCAGTCGCTGGGAAGGAAGGAGACGCCTAAACCGCGGCACTGCCCGGTTTGAGCGTAGCCAAACCTGCCCACCGGCTTTGTAGCCCCGATTCTCTGTGTTTTGCTCCCGTCTCCGACGAGAGAGGCGGCGACGGTGGCGTCTGCGACGGGAGACAGCGCGTCGGAGCGAGAGAGCGCTGCGCCTGCCGCCGCCCCAACAGCGGAGGCGCCGCCGCCATCGGTCGTCACCAGACCGGAGCCGCAGGCCCTCCCGAGCCCGGCCATCCGTGCCCCGCTCCCAGATCTCTATCCTTTTGGGACCATGCGCGGAGGAGGCTTTGGGGACCGGGACCGGGATCGTGACCGTGGAGGATTTGGAGCAAGAGGTGGTGGTGGCCTTCCCCCGAAGAAATTTGGTAATCCTGGGGAGCGTTTGCGTAAAAAAAAGTGGGATTTGAGTGAGCTCCCCAAGTTTGAGAAAAATTTTTATGTGGAACATCCGGAAGTAGCAAGGCTGACACCATATGAGGTTGATGAGCTACGCCGAAAGAAGGAGATTACAGTGAGGGGGGGAGATGTTTGTCCTAAACCCGTGTTTGCCTTCCATCATGCTAACTTCCCACAATATGTAATGGATGTGTTGATGGATCAGCACTTTACAGAACCAACTCCAATTCAGTGCCAGGGATTTCCGTTGGCTCTTAGTGGCCGGGATATGGTGGGCATTGCTCAGACTGGCTCTGGGAAGACGTTGGCGTATCTCCTGCCTGCAATTGTTCATATTAACCACCAGCCATACTTGGAAAGGGGAGATGGCCCAATCTGTCTAGTTCTGGCTCCTACCAGAGAGCTTGCCCAGCAAGTACAGCAGGTGGCCGATGACTATGGCAAATGTTCTAGATTGAAGAGTACTTGTATTTATGGAGGTGCTCCTAAAGGTCCCCAGATTCGAGACTTGGAAAGAGGTGTTGAGATCTGCATAGCCACTCCTGGACGTCTGATAGATTTCCTGGAGTCAGGAAAGACAAATCTTCGCCGATGTACTTACCTTGTATTGGACGAAGCTGACAGAATGCTTGATATGGGGTTTGAACCCCAGATCCGTAAAATTGTTGACCAAATCAGGCCTGATAGGCAGACACTGATGTGGAGTGCAACCTGGCCAAAAGAAGTAAGACAGCTTGCAGAGGATTTCCTTCGTGATTACACCCAGATCAACGTAGGCAATCTGGAGTTGAGTGCCAACCACAACATCCTCCAGATAGTGGATGTCTGCATGGAAAGTGAAAAAGACCACAAGTTGATCCAACTAATGGAAGAAATAATGGCTGAAAAGGAAAACAAAACAATAATATTTGTGGAGACAAAGAGACGCTGTGATGATCTGACTCGAAGGATGCGCAGAGATGGTTGGCCAGCTATGTGTATCCATGGAGACAAGAGTCAACCAGAAAGAGATTGGGTACTTAATGAGTTCCGTTCTGGAAAGGCACCCATCCTTATTGCTACAGATGTAGCCTCCCGTGGGCTAGGTTCTCCGGCGCTTGGCAACCAAATGGGGCTACAGAGAAGCATCTAAGCCAGTTCACAGAGCGAGCGTGTGTGGGGACTTCTCACTGCCACGGACCCTTGATGCATGCTCCCCGCGCTCCAGTGGTCCCGTGTCAGAAGGCGGAGTTTTCGAAAGGAGGCCGCCAAAAATAAAAGGCAAAGAGACGGGATCGGCTGCAGCGGTTTCCCAAAGGAGGAGGGAGTGTGCATCGGTCTGGTAACAAACAGAGAATGTTTTTTAATTATTTATATCACAAAAATCTGTGTTTTATCTAGGATATTTTCTGAATATTCTTTGTAAAATGCAGATTTTTTTCCACAAAACAGTAGGATTCTTTGTTATATTCTTAAAATTGTTTGTTTAAGTAGGTAAAAATATACATTCAGCTGAAAGCATTACACTAACATTTACATTTTAAGCCTTAGGAGGTTATTCAGCCCAATTCCCAGCAGTAGAGAGAATACTAAACTTGTGTCTCAAGGTTTCATGGTTTTCCCACGTTCTTTGGCTATTAATTTAATTTCCCAGGTCACGTAGACAATCATTGATAATTGAAACAAGTCCTGAGTTGAAATAACCTTGAGTTGAGCAAAAATATCCTCATTTTGGCAGAAGCTGGGCTTGGTAGTACAGTAAAATTTTAGTGTAATGTGCTCTTGTAATTGAAAGGGGATAGATAATCTGGATGTTTCTGCAAAGGAAAATAGGTGTGTACTTAACAGCTTTGGCTCTACTCAGTTTCTTAAAAAGATAAGAGCAAAAAAAGTTAAATGTTAATCAAAACATTTAAGTTTCCTTTAAATTGTAGTAATAAAATATATGAAGCTCCTTTTTTTACTTTGCTCTGTGACTGGTTTAAAGGTAAGTTTGTTATGTTGTTGGTAGATTTTGCCAGGCTTCTCCCAACAGAGTAGAAGTGATTTGGCCTCATAACTTCACAGTGGTTTACCACTTTGTTCTATGTTCTGGTTTTGTAAAGGATAGTACTGGAATTTGCGTCTGAAGACCAATATTGGTGTAACTCCTGTCAGTATATTGGTAAAATGTAGCAGAGGCAGGAGTTTGGATGTTTGGATGGGATTCCCTTAGGATTCTACAGCCAATAAAGATCCTATTTCCTATGCATGTCCCAGGAATCAGTAATCCTCTTTTACTCTGTTGGGATGAGTCTTTTTTTGTTTCTGTTCAGAGTGGTTACTAACTTCACCTTCTTTCCTCTTGCTGTCATCTGCATTCGTGCTTCCCACCTGTTGTTGGCATGTCCTTTACCTTCTCTTTCCCTGCCACATCAACCTACACACTGACTCATCATTGACGTGGAAGATGTGGAAGATGTCAAGTTTGTGATCAACTATGACTATCCAAACAGCTCAGAGGATTATGTGCACCGTATTGGCCGAACAGCCCGTAGCACCAACAAGGGTACCGCCTATACCTTCTTCACCCCAGGGAACCTAAAACAGGCCAGAGAGCTTATCAAAGTGCTGGAAGAGGCCAATCAGGCTATCAATCCAAAACTGATGCAGCTTGTGGACCACAGAGGAGGCGGCGGAGGCGGGGG