Transcript asmbl_112075

Sequence
Transcript Sequence for observation asmbl_112075 of TGE0015877:
AGCCGACTCAGCGGCGGCCGCCATTTTGTGCAGTCGCTGGGAAGGAAGGAGACGCCTAAACCGCGGCACTGCCCGGTTTGAGCGTAGCCAAACCTGCCCACCGGCTTTGTAGCCCCGATTCTCTGTGTTTTGCTCCCGTCTCCGACGAGAGAGGCGGCGACGGTGGCGTCTGCGACGGGAGACAGCGCGTCGGAGCGAGAGAGCGCTGCGCCTGCCGCCGCCCCAACAGCGGAGGCGCCGCCGCCATCGGTCGTCACCAGACCGGAGCCGCAGGCCCTCCCGAGCCCGGCCATCCGTGCCCCGCTCCCAGATCTCTATCCTTTTGGGACCATGCGCGGAGGAGGCTTTGGGGACCGGGACCGGGATCGTGACCGTGGAGGATTTGGAGCAAGAGGTGGTGGTGGCCTTCCCCCGAAGAAATTTGGTAATCCTGGGGAGCGTTTGCGTAAAAAAAAGTGGGATTTGAGTGAGCTCCCCAAGTTTGAGAAAAATTTTTATGTGGAACATCCGGAAGTAGCAAGGCTGACACCATATGAGGTTGATGAGCTACGCCGAAAGAAGGAGATTACAGTGAGGGGGGGAGATGTTTGTCCTAAACCCGTGTTTGCCTTCCATCATGCTAACTTCCCACAATATGTAATGGATGTGTTGATGGATCAGCACTTTACAGAACCAACTCCAATTCAGTGCCAGGGATTTCCGTTGGCTCTTAGTGGCCGGGATATGGTGGGCATTGCTCAGACTGGCTCTGGGAAGACGTTGGCGTATCTCCTGCCTGCAATTGTTCATATTAACCACCAGCCATACTTGGAAAGGGGAGATGGCCCAATCTGTCTAGTTCTGGCTCCTACCAGAGAGCTTGCCCAGCAAGTACAGCAGGTGGCCGATGACTATGGCAAATGTTCTAGATTGAAGAGTACTTGTATTTATGGAGGTGCTCCTAAAGGTCCCCAGATTCGAGACTTGGAAAGAGGTGTTGAGATCTGCATAGCCACTCCTGGACGTCTGATAGATTTCCTGGAGTCAGGAAAGACAAATCTTCGCCGATGTACTTACCTTGTATTGGACGAAGCTGACAGAATGCTTGATATGGGGTTTGAACCCCAGATCCGTAAAATTGTTGACCAAATCAGGCCTGATAGGCAGACACTGATGTGGAGTGCAACCTGGCCAAAAGAAGTAAGACAGCTTGCAGAGGATTTCCTTCGTGATTACACCCAGATCAACGTAGGCAATCTGGAGTTGAGTGCCAACCACAACATCCTCCAGATAGTGGATGTCTGCATGGAAAGTGAAAAAGACCACAAGTTGATCCAACTAATGGAAGAAATAATGGCTGAAAAGGAAAACAAAACAATAATATTTGTGGAGACAAAGAGACGCTGTGATGATCTGACTCGAAGGATGCGCAGAGATGGTTGGCCAGCTATGTGTATCCATGGAGACAAGAGTCAACCAGAAAGAGATTGGGTACTTAATGAGTTCCGTTCTGGAAAGGCACCCATCCTTATTGCTACAGATGTAGCCTCCCGTGGGCTAGGTTCTCCGGCGCTTGGCAACCAAATGGGGCTACAGAGAAGCATCTAAGCCAGTTCACAGAGCGAGCGTGTGTGGGGACTTCTCACTGCCACGGACCCTTGATGCATGCTCCCCGCGCTCCAGTGGTCCCGTGTCAGAAGGCGGAGTTTTCGAAAGGAGGCCGCCAAAAATAAAAGGCAAAGAGACGGGATCGGCTGCAGCGGTTTCCCAAAGGAGGAGGGAGTGTGCATCGGTCTGGTAACAAACAGAGAATGTTTTTTAATTATTTATATCACAAAAATCTGTGTTTTATCTAGGATATTTTCTGAATATTCTTTGTAAAATGCAGATTTTTTTCCACAAAACAGTAGGATTCTTTGTTATATTCTTAAAATTGTTTGTTTAAGTAGGTAAAAATATACATTCAGCTGAAAGCATTACACTAACATTTACATTTTAAGCCTTAGGAGGTTATTCAGCCCAATTCCCAGCAGTAGAGAGAATACTAAACTTGTGTCTCAAGGTTTCATGGTTTTCCCACGTTCTTTGGCTATTAATTTAATTTCCCAGGTCACGTAGACAATCATTGATAATTGAAACAAGTCCTGAGTTGAAATAACCTTGAGTTGAGCAAAAATATCCTCATTTTGGCAGAAGCTGGGCTTGGTAGTACAGTAAAATTTTAGTGTAATGTGCTCTTGTAATTGAAAGGGGATAGATAATCTGGATGTTTCTGCAAAGGAAAATAGGTGTGTACTTAACAGCTTTGGCTCTACTCAGTTTCTTAAAAAGATAAGAGCAAAAAAAGTTAAATGTTAATCAAAACATTTAAGTTTCCTTTAAATTGTAGTAATAAAATATATGAAGCTCCTTTTTTTACTTTGCTCTGTGACTGGTTTAAAGGTAAGTTTGTTATGTTGTTGGTAGATTTTGCCAGGCTTCTCCCAACAGAGTAGAAGTGATTTGGCCTCATAACTTCACAGTGGTTTACCACTTTGTTCTATGTTCTGGTTTTGTAAAGGATAGTACTGGAATTTGCGTCTGAAGACCAATATTGGTGTAACTCCTGTCAGTATATTGGTAAAATGTAGCAGAGGCAGGAGTTTGGATGTTTGGATGGGATTCCCTTAGGATTCTACAGCCAATAAAGATCCTATTTCCTATGCATGTCCCAGGAATCAGTAATCCTCTTTTACTCTGTTGGGATGAGTCTTTTTTTGTTTCTGTTCAGAGTGGTTACTAACTTCACCTTCTTTCCTCTTGCTGTCATCTGCATTCGTGCTTCCCACCTGTTGTTGGCATGTCCTTTACCTTCTCTTTCCCTGCCACATCAACCTACACACTGACTCATCATTGACGTGGAAGATGTGGAAGATGTCAAGTTTGTGATCAACTATGACTATCCAAACAGCTCAGAGGATTATGTGCACCGTATTGGCCGAACAGCCCGTAGCACCAACAAGGGTACCGCCTATACCTTCTTCACCCCAGGGAACCTAAAACAGGCCAGAGAGCTTATCAAAGTGCTGGAAGAGGCCAATCAGGCTATCAATCCAAAACTGATGCAGCTTGTGGACCACAGAGGAGGCGGCGGAGGCGGGGG