Transcript asmbl_105835

Sequence
Transcript Sequence for observation asmbl_105835 of TGE0057450:
CAACTGTCAGTGAGCCTGCGCAGGAGGCCAATAGGCTGCCAATACTCCTTGGACTCCCCGCCAGGGCCCTGCTGTCAGTGCGCCTGCGCGCGGGTCCGGCGCCGAGGTTCTTGACTGCTGTGCCGGACGCCAGGTGTAGCCATGCAGCGAGCCGATTCCGAGCAGCCCTCCAAGCGTCCCCGTTGCGATGACAGCCCGAGAACCCCCTCAAACACCCCTTCCGCAGAGGCAGACTGGTCCCCGGGCCTGGAACTCCATCCCGACTACAAGACATGGGGTCCGGAGCAGGTGTGCTCCTTCCTCAGGCGCGGTGGCTTTGAAGAGCCGGTGCTGCTGAAGAACATCCGAGAAAATGAAATCACAGGCGCATTACTGCCTTGTCTTGATGAGTCTCGTTTTGAAAATCTTGGAGTAAGTTCCTTGGGGGAGAGGAAGAAGCTGCTTAGTTATATCCAGCGATTGGTTCAAATCCACGTTGATACAATGAAGGTAATTAATGATCCTATCCATGGCCACATTGAGCTCCACCCTCTCCTCGTCCGAATCATTGATACACCTCAATTTCAACGTCTTCGATACATCAAACAGCTGGGAGGTGGTTACTATGTTTTTCCAGGAGCTTCACACAATCGATTTGAGCATAGTCTAGGGGTGGGGTATCTAGCAGGATGTCTAGTTCACGCACTGGGTGAAAAACAACCAGAGCTGCAGATAAGTGAACGAGATGTTCTCTGTGTTCAGATTGCTGGACTTTGTCATGATCTCGGTCATGGGCCATTTTCTCACATGTTTGATGGACGATTTATTCCACTTGCTCGCCCGGAGGTGAAATGGACGCATGAACAAGGCTCAGTTATGATGTTTGAGCACCTTATTAATTCTAATGGAATTAAGCCTGTCATGGAACAATATGGTCTCATCCCTGAAGAAGATATTTGCTTTATAAAGGAACAAATTGTAGGACCACTTGAATCACCTGTCGAAGATTCATTGTGGCCATATAAAGGGCGTCCTGAAAACAAAAGCTTCCTTTATGAGATAGTATCTAATAAAAGAAATGGCATTGATGTGGACAAATGGGATTATTTTGCCAGGGACTGCCATCATCTTGGAATCCAAAATAATTTTGATTACAAGCGCTTTATTAAGTTTGCCCGTGTCTGTGAAGTAGACAATGAGTTGCGTATTTGTGCTAGAGATAAGGAAGTTGGAAATCTGTATGACATGTTCCACACTCGCAACTCTTTACACCGTAGAGCTTATCAACACAAAGTTGGCAACATTATTGATACAATGATTACAGATGCTTTCCTCAAAGCAGATGACTACATAGAGATTACAGGTGCTGGAGGAAAAAAGTATCGCATTTCTACAGCAATTGACGACATGGAAGCCTATACTAAGCTGACAGATAACATTTTTCTGGAGATTTTATACTCTACTGATCCCAAATTGAAAGACGCACGAGAGATTTTAAAACAAATTGAATACCGTAATCTATTCAAGTATGTGGGTGAGACGCAGCCAACAGGACAAATAAAGATTAAAAGGGAGGACTATGAATCTCTTCCAAAAGAGGTTGCCAGTGCTAAACCCAAAGTATTGCTAGACGTGAAACTGAAGGCTGAAGATTTTATAGTGGATGTTTCACAACTTCTGCCAGAGAAATTTGCAGAGCAGCTGATTCGAGTATATTGTAAGAAGGTGGACAGAAAGAGTTTGTATGCCGCAAGACAATATTTTGTTCAGTGGTGTGCAGACAGAAATTTCACCAAGCCGCAGGATGGCGATGTTATAGCCCCACTCATAACACCTCAAAAAAAGGAATGGAACGACAGTACTTCAGTCCAAAATCCAACTCGCCTCCGAGAAGCATCCAAAAGCAGAGTCCAGCTTTTTAAAGATGACCCAATGTGAATGTCTGTAGTCAGTTGTTTACAAACTCCCTCTCCTGCACAATTCATTTAGAGGCTTCAATCATAGAATTCTGCAAATTAATGACAACTCATGCTTTAATTTTGTATTTTGAATGTACACGCATGCTGAAGCTAAGTAACTTTTAATCAAAGAAATAAGATGGTATTAGGCAAATCTTACTATACTATGAAAAGCATTACCTTGCCTATTTTTAATATTATTAAAGCCTTTCTCCTTCAGTAGTCTATTTTCTTAGAATAACAACTCTTTTATCTATTCTGAACTCTATTTTTTTTCTTTTTTAAGAGACAAGGTTTTGCTCTGTTGCCCAGCTTGGACTCGAACTTTCCTGGGCTCAAGCGACCCTCCTGCCTCAGCCCCCCAAGTAGCTGGGACTAAAGTCATGTGCCACCACACCCAGCTTACTCTGAACTTTTATGACAGATGATTGTTTTTTGTTTTTAATGTAGAAATGAGACAAGGGTACAAATTGGAACTAGAAATTGACATTGTCATTGACAAACATGGCTAAAAACAAAACATCAAATCCTGCCCCCGTGAAGAGTTCCCTGTCACCTCAAGTTTGAGGATAGTCCTCTAAGAGTGACCTAAGCATAAGTGAAAGACACCTCCCCTCACCCTTCTAGCCCCCTACAAGGTGCCAGGTTGGGGTAAAGAGTTGGAGATGATGGCCAGGAGTGGCCTCCAACACGCTGGTGAGAGGCCTGATTAGGTTTTGGGGAAGATCTGAGAGCTCTGGCCTCTTCGTGAGTGGAACATAAAGCCGCCTCTTGTTGGGAGATCCTACCCCAGTGACAGAGGAATCCCCCAAACTAGGCTGTGCCCTGGCTCCGTGGCGGCTCCAGACCCGGGTAGTGCCTTTGTCCCCTGAATACTCACTCCCCCGGTCCAGAGGGCCTTCCCACTGCCCAGCCTGGAGAAGGCCTCCCCTGACCTGCTCTCTCAGTATCCTGGAGAGCTGGCCAGAGGCCATCACAGGCATCATCCTCAGAGCTCCTCAGACCTGGGACTTTGTTTTTGCTGGTTCAGTGCATTTTGTGTATTTAAGAGCAAACACTAGCCAGGCGTGGCGGCGTGTGCCTGTAGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGGATTGCT