Transcript asmbl_101816

Sequence
Transcript Sequence for observation asmbl_101816 of TGE0057450:
CAACTGTCAGTGAGCCTGCGCAGGAGGCCAATAGGCTGCCAATACTCCTTGGACTCCCCGCCAGGGCCCTGCTGTCAGTGCGCCTGCGCGCGGGTCCGGCGCCGAGGTTCTTGACTGCTGTGCCGGACGCCAGGTGTAGCCATGCAGCGAGCCGATTCCGAGCAGCCCTCCAAGCGTCCCCGTTGCGATGACAGCCCGAGAACCCCCTCAAACACCCCTTCCGCAGAGGCAGACTGGTCCCCGGGCCTGGAACTCCATCCCGACTACAAGACATGGGGTCCGGAGCAGGTGTGCTCCTTCCTCAGGCGCGGTGGCTTTGAAGAGCCGGTGCTGCTGAAGAACATCCGAGAAAATGAAATCACAGGCGCATTACTGCCTTGTCTTGATGAGTCTCGTTTTGAAAATCTTGGAGTAAGTTCCTTGGGGGAGAGGAAGAAGCTGCTTAGTTATATCCAGCGATTGGTTCAAATCCACGTTGATACAATGAAGGTAATTAATGATCCTATCCATGGCCACATTGAGCTCCACCCTCTCCTCGTCCGAATCATTGATACACCTCAATTTCAACGTCTTCGATACATCAAACAGCTGGGAGGTGGTTACTATGTTTTTCCAGGAGCTTCACACAATCGATTTGAGCATAGTCTAGGGGTGGGGTATCTAGCAGGATGTCTAGTTCACGCACTGGGTGAAAAACAACCAGAGCTGCAGATAAGTGAACGAGATGTTCTCTGTGTTCAGATTGCTGGACTTTGTCATGATCTCGGTCATGGGCCATTTTCTCACATGTTTGATGGACGATTTATTCCACTTGCTCGCCCGGAGGTGAAATGGACGCATGAACAAGGCTCAGTTATGATGTTTGAGCACCTTATTAATTCTAATGGAATTAAGCCTGTCATGGAACAATATGGTCTCATCCCTGAAGAAGATATTTGCTTTATAAAGGAACAAATTGTAGGACCACTTGAATCACCTGTCGAAGATTCATTGTGGCCATATAAAGGGCGTCCTGAAAACAAAAGCTTCCTTTATGAGATAGTATCTAATAAAAGAAATGGCATTGATGTGGACAAATGGGATTATTTTGCCAGGGACTGCCATCATCTTGGAATCCAAAATAATTTTGATTACAAGCGCTTTATTAAGTTTGCCCGTGTCTGTGAAGTAGACAATGAGTTGCGTATTTGTGCTAGAGATAAGGAAGTTGGAAATCTGTATGACATGTTCCACACTCGCAACTCTTTACACCGTAGAGCTTATCAACACAAAGTTGGCAACATTATTGATACAATGATTACAGATGCTTTCCTCAAAGCAGATGACTACATAGAGATTACAGGTGCTGGAGGAAAAAAGTATCGCATTTCTACAGCAATTGACGACATGGAAGCCTATACTAAGCTGACAGATAACATTTTTCTGGAGATTTTATACTCTACTGATCCCAAATTGAAAGACGCACGAGAGATTTTAAAACAAATTGAATACCGTAATCTATTCAAGTATGTGGGTGAGACGCAGCCAACAGGACAAATAAAGATTAAAAGGGAGGACTATGAATCTCTTCCAAAAGAGGTTGCCAGTGCTAAACCCAAAGTATTGCTAGACGTGAAACTGAAGGCTGAAGATTTTATAGTGGATGTTTCACAACTTCTGCCAGAGAAATTTGCAGAGCAGCTGATTCGAGTATATTGTAAGAAGGTGGACAGAAAGAGTTTGTATGCCGCAAGACAATATTTTGTTCAGTGGTGTGCAGACAGAAATTTCACCAAGCCGCAGGATGGCGATGTTATAGCCCCACTCATAACACCTCAAAAAAAGGAATGGAACGACAGTACTTCAGTCCAAAATCCAACTCGCCTCCGAGAAGCATCCAAAAGCAGAGTCCAGCTTTTTAAAGATGACCCAATGTGAATGTCTGTAGTCAGTTGTTTACAAACTCCCTCTCCTGCACAATTCATTTAGAGGCTTCAATCATAGAATTCTGCAAATTAATGACAACTCATGCTTTAATTTTGTATTTTGAATGTACACGCATGCTGAAGCTAAGTAACTTTTAATCAAAGAAATAAGATGGTATTAGGCAAATCTTACTATACTATGAAAAGCATTACCTTGCCTATTTTTAATATTATTAAAGCCTTTCTCCTTCAGTAGTCTATTTTCTTAGAATAACAACTCTTTTATCTATTCTGAACTCTATTTTTTTTCTTTTTTAAGAGACAAGGTTTTGCTCTGTTGCCCAGCTTGGACTCGAACTTTCCTGGGCTCAAGCGACCCTCCTGCCTCAGCCCCCCAAGTAGCTGGGACTAAAGTCATGTGCCACCACACCCAGCTTACTCTGAACTTTTATGACAGATGATTGTTTTTTGTTTTTAATGTAGAAATGAGACAAGGGTACAAATTGGAACTAGAAATTGACATTGTCATTGACAAACATGGCTAAAAACAAAACATCAAATCCTGCCCCCGTGAAGAGTTCCCTGTCACCTCAAGTTTGAGGATAGTCCTCTAAGAGTGACCTAAGCATAAGTGAAAGACACCTCCCCTCACCCTTCTAGCCCCCTACAAGGTGCCAGGTTGGGGTAAAGAGTTGGAGATGATGGCCAGGAGTGGCCTCCAACACGCTGGTGAGAGGCCTGATTAGGTTTTGGGGAAGATCTGAGAGCTCTGGCCTCTTCGTGAGTGGAACATAAAGCCGCCTCTTGTTGGGAGATCCTACCCCAGTGACAGAGGAATCCCCCAAACTAGGCTGTGCCCTGGCTCCGTGGCGGCTCCAGACCCGGGTAGTGCCTTTGTCCCCTGAATACTCACTCCCCCGGTCCAGAGGGCCTTCCCACTGCCCAGCCTGGAGAAGGCCTCCCCTGACCTGCTCTCTCAGTATCCTGGAGAGCTGGCCAGAGGCCATCACAGGCATCATCCTCAGAGCTCCTCAGACCTGGGACTTTGTTTTTGCTGGTTCAGTGCATTTTGTGTATTTAAGAGCAAACACTAGCCAGGCGTGGCGGCGTGTGCCTGTAGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGGATTGCT