Transcript asmbl_97416

Sequence
Transcript Sequence for observation asmbl_97416 of TGE0056073:
AGAGAGAAGATGACTCAGGTGAGGCTCGGCCGACGCCCGTGCTCCTCCCGTCCTTTCCCCAGTCATTTTCTGCCCGGCTTGATTTCTGACATTTAAGTGTTTCTTTCGCTGTTCCAGGCTCTGTTCCTCTCCCGGCATTTCCTCCCTGAAGCCTCCAGGTTTCTCATTTGGTTTCTGCCTGCGTTCTTTTCTTTTCTCCACACATCACACTGGCATGCAGCATGTTGTGGCGTGTGAGCATGGGGTGGCCGTGGGTCTCTGTCCCTGACTAAGCCGCCCCTTGTCCCTTCTCAGATTATGTTTGAGACCTTCAACACCCCGGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTCTACGCCTCTGGGCGCACCACTGGCATTGTCATGGACTCTGGAGACGGGGTCACCCACACGGTGCCCATCTACGAGGGCTACGCCCTCCCCCACGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACCGACTACCTCATGAAGATCCTCACTGAGCGAGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGCGACATCAAGGAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAGGAGATGGCCACCGCCGCATCCTCCTCTTCTCTGGAGAAGAGCTACGAGCTGCCCGATGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGGTGTCCGGAGGCGCTGTTCCAGCCTTCCTTCCTGGGTATGGAATCTTGCGGCATCCACGAGACCACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACGGTGCTGTCGGGCGGCACCACCATGTACCCGGGCATTGCCGACAGGATGCAGAAGGAGATCACCGCCCTGGCGCCCAGCACCATGAAGATCAAGATCATCGCACCCCCAGAGCGCAAGTACTCGGTGTGGATCGGTGGCTCCATCCTGGCCTCACTGTCCACCTTCCAGCAGATGTGGATTAGCAAGCAGGAGTACGACGAGTCGGGCCCCTCCATCGTCCACCGCAAATGCTTCTAAACGGACTCAGCAGATGCGTAGCATTTGCTGCATGGGTTAATTGAGAATAGAAATTTGCCCCTGGCAAATGCACACACCTCATGCTAGCCTCACGAAACTGGAATAAGCCTTCGAAAAGAAATTGTCCTTGAAGCTTGTATCTGATATCAGCACTGGATTGTAGAACTTGTTGCTGATTTTGACCTTGTATTGAAGTTAACTGTTCCCCTTGGTATTTGTTTAATACCCTGTACATATCTTTGAGTTCAACCTTTAGTACGTGTGGCTTGGTCACTTCGTGGCTAAGGTAAGAACGTGCTTGTGGAAGACAAGTCTGTGGCTTGGTGAGTCTGTGTGGCCAGCAGCCTCTGATCTGTGCAGGGTATTAACGTGTCAGGGCTGAGTGTTCTGGGATTTCTCTAGAGGCTGGCAAGAACCAGTTGTTTTGTCTTGCGGGTCTGTCAGGGTTGGAAAGTCCAAGCCGTAGGACCCAGTTTCCTTTCTTAGCTGATGTCTTTGGCCAGAACACCGTGGGCTGTTACTTGCTTTGAGTTGGAAGCGGTTTGCATTTACGCCTGTAAATGTATTCATTCTTAATTTATGTAAGGTTTTTTTTGTACGCAATTCTCGATTCTTTGAAGAGATGACAACAAATTTTGGTTTTCTACTGTTATGTGAGAACATTAGGCCCCAGCAACACGTCATTGTGTAAGGAAAAATAAAAGTGCTGCCGTAACC