Transcript asmbl_96334

Sequence
Transcript Sequence for observation asmbl_96334 of TGE0058029:
ACCAGAGGGAGCCAGGGCTGCAGCCTCATCTGTTTGCGGATCAGAACCCGAGCTGTGCTTGTGGCTGCGGCTGCTAACTGGCTGCGCACAGGGAGCTGTCACCATGCCTCACTCGTACCCAGCCCTTTCTGCTGAGCAGAAGAAGGAGTTGTCTGACATTGCCCTGCGGATTGTAGCCCCGGGCAAAGGCATTCTGGCTGCGGATGAGTCTGTAGGCAGCATGGCCAAGCGGCTGAGCCAAATTGGGGTGGAAAACACAGAGGAGAACCGCCGGCTGTACCGCCAGGTCCTGTTCAGTGCTGATGACCGTGTGAAAAAGTGCATTGGAGGCGTCATTTTCTTCCATGAGACCCTCTACCAGAAAGATGATAATGGTGTTCCCTTCGTCCGAACCATCCAGGATAAGGGCATCGTCGTGGGCATCAAGGTTGACAAGGGTGTGGTGCCTCTAGCTGGGACTGATGGAGAAACCACCACTCAAGGGCTGGATGGGCTCTCAGAACGCTGTGCCCAATACAAGAAGGATGGTGCTGACTTTGCCAAGTGGCGCTGTGTGCTGAAAATCAGTGAGCGTACACCCTCTGCACTTGCCATTCTGGAGAACGCCAACGTGCTGGCCCGTTATGCCAGTATCTGCCAGCAGAATGGCATTGTGCCTATTGTGGAACCTGAAATATTGCCTGATGGAGACCACGACCTCAAACGTTGTCAGTATGTTACAGAGAAGGTCTTGGCTGCTGTGTACAAGGCCCTGAGTGACCATCATGTATACCTGGAGGGGACCCTGCTCAAGCCCAACATGGTGACCCCGGGCCATGCCTGTCCCATCAAGTATACCCCAGAGGAGATTGCCATGGCAACTGTCACTGCCCTGCGTCGCACTGTGCCCCCAGCTGTCCCAGGAGTGACCTTCCTGTCTGGGGGTCAGAGCGAAGAAGAGGCATCATTCAACCTCAATGCCATCAACCGCTGCCCCCTTCCCCGACCCTGGGCGCTTACCTTCTCCTATGGGCGTGCCCTGCAAGCCTCTGCACTCAATGCCTGGCGAGGGCAACGGGACAATGCTGGGGCTGCCACTGAGGAGTTCATCAAGCGGGCTGAGGTGAATGGGCTTGCAGCCCAGGGCAAGTATGAAGGCAGTGGAGAAGATGGTGGAGCAGCAGCACAGTCACTCTACATTGCCAACCATGCCTACTGAGTATCCACTCCATACCACAGCCCTTGGCCCAGCCATCTGCACCCACTTTTGCTTGTAGTCATGGCCAGGGCCAAATAGCTATGCAGAGCAGAGATGCCTTCACCTGGCACCAACTTGTCTTCCTTTCTCTCTTCCCTTCCCCTCTCTCATTGCTGCACCTGGGACCATAGGATGGGAGGATAGGGAGCCCCTCATGACTGAGGGCAGAAGAAATTGCTAGAAGTCAGAACAGGATGGCTGGGTCTCCCCCTACCTCTTCCAGCTCCCACAATTTTCCCATGATGAGGTAGCTTCTCCCTGGGCTCTCCTTCTTGCCTGCCCTGTCTCCTGGGATCAGAGGGTAGTACAGAAGCCCTGACTCATGCCTTGAGTACATACCATACAGCAAATAAATGGTAGCAAAACATTC