Transcript asmbl_77974

Sequence
Transcript Sequence for observation asmbl_77974 of TGE0000626:
TCTCGCCCGGCGCCGCCGGAAAGCAGCCTCTCCAACGCCTGCCGGAAAGCAGCCCGGCCCGGCATTTTACGACGTTCGCAGCGCTACCCTTTTCCGCTCCACGGTGACCTCCGTGCGGCCGGGTGCGGGCGGAGTCTTCCTCGATCCCGTGGTGCTCCGCGGCGCGGCCTTGCTCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGGCTACCAGGGTATTTAGCCTAGTTGGCAAGCGAGCAATTTCCACCTCTGTGTGTGTACGAGCTCATGAAAGTGTTGTGAAGAGCGAAGACTTTTCGCTCCCAGCTTATATGGATCGGCGTGACCACCCCTTGCCGGAGGTGGCCCATGTCAAGCACCTGTCTGCCAGCCAGAAGGCATTGAAGGAGAAGGAGAAGGCCTCCTGGAGCAGCCTCTCCATGGATGAGAAAGTCGAGTTGTATCGCATTAAGTTCAAGGAGAGCTTTGCTGAGATGAACAGGGGCTCGAACGAGTGGAAGACGGTTGTGGGCGGTGCCATGTTCTTCATCGGTTTCACCGCGCTCGTTATCATGTGGCAGAAGCACTATGTGTACGGCCCCCTCCCGCAAAGCTTTGACAAAGAGTGGGTGGCCAAGCAGACCAAGAGGATGCTGGACATGAAGGTGAACCCCATCCAGGGCTTAGCCTCCAAGTGGGACTACGAAAAGAACGAGTGGAAGAAGTGAGAGATGCTGGCCTGCGCCTGCACCTGCGCCTGGCTCTGTCACCGCCATGCAACTCCATGCCTATTTACTGGAAACCTGTTATGCCAAACAGTTGTACCACTGCTAATAAATGACCAGTTTACCTGAAA