Transcript asmbl_69540

Sequence
Transcript Sequence for observation asmbl_69540 of TGE0000491:
GTCGCCCGGAGCCGGGATTGGGCAGAGGGCGGGGCGGCGGAGGGATTGCGGCGGCCCGCAGCGGGATAACCTTGAGGCTGAGGCAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAGTCGGTCAGCGCCGGAGGACCTCAGCAGCCATGTCGAAGCCCCATAGTGAAGCCGGGACTGCCTTCATTCAGACCCAGCAGCTGCACGCAGCCATGGCTGACACATTCCTGGAGCACATGTGCCGCCTGGACATTGATTCACCACCCATCACAGCCCGGAACACTGGCATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACGTTGAAGGAGATGATTAAGTCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACTCATGAGTACCATGCGGAGACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGGCCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGCAGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAACGCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAGGTGGTGGAAGTGGGCAGCAAGATCTACGTGGATGATGGGCTTATTTCTCTCCAGGTGAAGCAGAAAGGTGCCGACTTCCTGGTGACGGAGGTGGAAAATGGTGGCTCCTTGGGCAGCAAGAAGGGTGTGAACCTTCCTGGGGCTGCTGTGGACTTGCCTGCTGTGTCGGAGAAGGACATCCAGGATCTGAAGTTTGGGGTCGAGCAGGATGTTGATATGGTGTTTGCGTCATTCATCCGCAAGGCATCTGATGTCCATGAAGTTAGGAAGGTCCTGGGAGAGAAGGGAAAGAACATCAAGATTATCAGCAAAATCGAGAATCATGAGGGGGTTCGGAGGTTTGATGAAATCCTGGAGGCCAGTGATGGGATCATGGTGGCTCGTGGTGATCTAGGCATTGAGATTCCTGCAGAGAAGGTCTTCCTTGCTCAGAAGATGATGATTGGACGGTGCAACCGAGCTGGGAAGCCTGTCATCTGTGCTACTCAGATGCTGGAGAGCATGATCAAGAAGCCCCGCCCCACTCGGGCTGAAGGCAGTGATGTGGCCAATGCAGTCCTGGATGGAGCCGACTGCATCATGCTGTCTGGAGAAACAGCCAAAGGGGACTATCCTCTGGAGGCTGTGCGCATGCAGCACCTGATTGCCCGTGAGGCAGAGGCTGCCATCTACCACTTGCAATTATTTGAGGAACTCCGCCGCCTGGCGCCCATTACCAGCGACCCCACAGAAGCCACCGCCGTGGGTGCCGTGGAGGCCTCCTTCAAGTGCTGCAGTGGGGCCATAATCGTCCTCACCAAGTCTGGCAGGTCTGCTCACCAGGTGGCCAGATACCGCCCACGTGCCCCCATCATTGCTGTGACCCGGAATCCCCAGACAGCTCGTCAGGCCCACCTGTACCGTGGCATCTTCCCTGTGCTGTGCAAGGACCCAGTCCAGGAGGCCTGGGCTGAGGACGTGGACCTCCGGGTGAACTTTGCCATGAATGTTGGCAAGGCCCGAGGCTTCTTCAAGAAGGGAGATGTGGTCATTGTGCTGACCGGATGGCGCCCTGGCTCCGGCTTCACCAACACCATGCGTGTTGTTCCTGTGCCGTGATGGACCCCAGAGCCCCTCCTCCAGCCCCTGTCCCACCCCCTTCCCCCAGCCCATCCATTAGGCCAGCAACGCTTGTAGAACTCACTCTGGGCTGTAACGTGGCACTGGTAGGTTGGGACACCAGGGAAGAAGATCAACGCCTCACTGAAACATGGCTGTGTTTGCAGCCTGCTCTAGTGGGACAGCCCAGAGCCTGGCTGCCCATCATGTGGCCCCACCCAATCAAGGGAAGAAGGAGGAATGCTGGACTGGAGGCCCCTGGAGCCAGATGGCAAGAGGGTGACAGCTTCCTTTCCTGTGTGTACTCTGTCCAGTTCCTTTAGAAAAAATGGATGCCCAGAGGACTCCCAACCCTGGCTTGGGGTCAAGAAACAGCCAGCAAGAGTTAGGGGCCTTAGGGCACTGGGCTGTTGTTCCATTGAAGCCGACTCTGGCCCTGGCCCTTACTTGCTTCTCTAGCTCTCTAGGCCTCTCCAGTTTGCACCTGTCCCCACCCTCCACTCAGCTGTCCTGCAGCAAACACTCCACCCTCCACCTTCCATTTTCCCCCACTACTGCAGCACCTCCAGGCCTGTTGCTATAGAGCCTACCTGTATGTCAATAAACAACAGCTGAAGCA