Transcript asmbl_69426

Sequence
Transcript Sequence for observation asmbl_69426 of TGE0057029:
GGAGCCCAATGAGGGAGCAATAACGTGGCAACCACCCACGAGCCCGCGTCGGTGCCCGCCCCGCAGGGGGACCTACTATCCGGCGCCGAGCCGGAGGGGGGAAACGGCGCCCGCCGCCCGCCCGGAGCCCGCGAGCAACCCCAGTCCCCCCCACCCGCGCGTGGCGGCGCCGGCTCCCTAGCCACCGCGGCCCCACCCTCTTCCGGCCTCAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTCATCGCGGGGTCCGTCTTCTTCCTGCTGCTGCCGGGACCTTCTGCGGCCGATGAGAAGAAGAAGGGGCCCAAAGTCACCGTCAAGGTGTATTTTGACCTACGAATTGGAGATGAAGATGTAGGCCGGGTGATCTTTGGTCTCTTCGGAAAGACTGTTCCAAAAACAGTGGATAATTTTGTGGCCTTAGCTACAGGAGAGAAAGGATTTGGCTACAAAAACAGCAAATTCCATCGTGTAATCAAGGACTTCATGATCCAGGGCGGAGACTTCACCAGGGGAGATGGCACAGGAGGAAAGAGCATCTACGGTGAGCGCTTCCCCGATGAGAACTTCAAACTGAAGCACTACGGGCCTGGCTGGGTGAGCATGGCCAACGCAGGCAAAGACACCAACGGCTCCCAGTTCTTCATCACGACAGTCAAGACAGCCTGGCTAGATGGCAAGCATGTGGTGTTTGGCAAAGTTCTAGAGGGCATGGAGGTGGTGCGGAAGGTGGAGAGCACCAAGACAGACAGCCGGGATAAACCCCTGAAGGATGTGATCATCGCAGACTGCGGCAAGATCGAGGTGGAGAAGCCCTTTGCCATCGCCAAGGAGTAGGGCACAGGGACATCTTTCTTTGAGTGACCGTCTGTGCAGGCCCTGTAGTCCGCCACAGGGCTCTGAGCTGCACTGGCCCCGGTGCTGGCATCTGGTGGAGCGGACCCACTCCCCTCACATTCCACAGGCCCATGGACTCACTTTTGTAACAAACTCCTACCAACACTGACCAATAAAAAAAAATGTGGGTTT