Transcript asmbl_21716

Sequence
Transcript Sequence for observation asmbl_21716 of TGE0004164:
GGGTGAGGTGGCTTTGAACCCGGGTTGCCCGGCCAGCGCGACCAAGGAGGTGGCTGGAGGACTGGAGAATGAACGGAGAAGCCGACTGTCCCACAGACCTGGAAATGGCCGCCCCCAAAGGCCAAGACCGCTGGTCCCAGGAAGACATGCTGACTTTGCTAGAATGCATGAAGAACAACCTTCCATCCAATGACAGCTCCAAGTTCAAAACCACTGAGTCACATATGGACTGGGAAAAAGTAGCATTTAAAGACTTTTCTGGAGACATGTGCAAGCTCAAATGGGTAGAGATTTCTAATGAGGTAAGGAAGTTCCGTACATTGACAGAATTGATCCTTGATGCTCAGGAACATGTTAAAAATCCTTACAAAGGCAAAAAACTCAAGAAACACCCGGACTTCCCAAAGAAGCCCCTGACCCCTTATTTCCGCTTCTTCATGGAGAAGCGGGCCAAGTATGCTAAACTCCACCCTGAGATGAGCAACCTGGACCTGACCAAGATCCTGTCCAAGAAATACAAGGAGCTGCCGGAGAAGAAGAAGATGAAATATATTCAGGACTTCCAGAGGGAGAAACAGGAGTTCGAGCGAAACCTGGCCCGATTCAGGGAGGATCACCCTGACCTAATCCAGAATGCCAAGAAGTCGGACATCCCCGAGAAGCCCAAAACCCCCCAGCAGCTGTGGTATACCCACGAGAAGAAAGTGTATCTCAAAGTGCGGCCAGATGCCACTACGAAGGAGGTGAAGGACTCCCTGGGGAAGCAGTGGTCTCAGCTCTCGGACAAAAAGAGGCTGAAATGGATTCATAAGGCCCTGGAGCAGCGGAAGGAGTACGAGGAGATTATGCGTGACTATATCCAGAAGCACCCTGAGCTGAACATCAGTGAGGAGGGCATCACCAAGTCCACCCTCACCAAGGCCGAACGCCAGCTCAAGGACAAGTTTGATGGGCGACCCACCAAGCCACCTCCGAACAGCTACTCGCTGTACTGTGCAGAGCTGATGGCCAACATGAAGGATGTGCCCAGCACAGAGCGCATGGTGCTATGCAGCCAGCAGTGGAAGCTGCTCTCCCAGAAGGAGAAGGATGCCTACCACAAGAAGTGTGACCAGAAAAAGAAGGATTATGAGGTGGAACTGCTCCGTTTTCTGGAGAGCCTGCCTGAGGAGGAGCAGCAGCGGGTGTTGGGAGAGGAGAAGATGCTGAACATCAATAAGAAGCAAGCAACCAGCCCAGCCTCCAAGAAGCCCTCCCAGGAAGGGGGCAAGGGTGGCTCAGAGAAGCCCAAGAGGCCCGTGTCGGCCATGTTTATCTTCTCTGAGGAGAAGCGGCGGCAGCTGCAAGAGGAACGGCCAGAGCTCTCAGAGAGCGAGCTGACCCGCCTGCTGGCCCGCATGTGGAACGACTTATCGGAGAAAAAGAAGGCCAAATACAAGGCTCGGGAGGCTGCGCTGAAGGCCCAGTCGGAAAGGAAGCCTGGCGGAGAGCGCGAGGAACGGGGCAAACTGCCCGAGTCACCCAAGAGAGCAGAGGAGATCTGGCAACAGAGTGTCATTGGCGACTACCTGGCTCGCTTCAAGAATGACCGGGTGAAGGCCTTGAAAGCCATGGAGATGACCTGGAACAACATGGAGAAGAAGGAGAAACTGATGTGGATTAAGAAGGCGGCAGAAGACCAAAAGCGATATGAGAGAGAGCTGAGTGAGATGCGGGCACCTCCGGCTGCTGCAAACTCATCCAAGAAGATGAAGTTCCAGGGAGAACCCAAGAAGCCTCCCATGAACGGTTACCAGAAGTTCTCCCAGGAGCTGCTGTCCAACGGGGAGCTGAACCACCTGCCGCTGAAGGAACGCATGGTAGAGATTGGCAGCCGCTGGCAGCGCATCTCTCAGAGCCAGAAAGAGCACTACAAAAAGTTGGCAGAGGAGCAGCAAAAGCAATACAAAGTGCACCTCGACCTCTGGGTCAAGAGTCTGTCTCCCCAGGACCGAGCAGCATATAAAGAATATATCTCCAATAAACGTAAGAGCATGACTAAGCTGCGAGGCCCAAACCCCAAGTCCAGCCGGACTACCCTGCAGTCCAAGTCGGAGTCTGAGGAGGAGGATGACGAGGATGAGGATGATGATGACGAGGATGAAGAGGAAGAAGATGATGAGAATGGAGACTCCTCTGAGGATGGCGGGGACTCCTCTGAGTCTAGCAGCGAGGATGAGAGCGAGGACGGGGATGAGAATGAGGATGACGATGAGGATGATGATGAGGATGATGATGAGGATGAGGATGAAGACAATGAGTCCGAGGCCAGCAGCTCCAGCTCTTCCTCCTCAGGGGACTCCTCAGACTCTGACTCCAACTGAGGCTGGGCCCCACCCGGGGCTCCCCTCCCCAACTGACCACCTTTGTTTCTCCCCCTTGTTCTGTCCCCTGCCCATGACCCACCC