Transcript asmbl_21688

Sequence
Transcript Sequence for observation asmbl_21688 of TGE0004161:
GTCGCAGGGCCCAACATCTGTACCACACGCGGTGTGAGCTCCTGCCAGCAGTGCCTGGCCGTGAGTCCCATGTGTGCCTGGTGCTCAGATGAGGCCCTGCCTCTGGGCTCTCCCCGCTGCAACCTGAAGGAGAATCTGCTGACGGATAACTGTGCCCTGGAGTCCATCGAGTTCCCCATCAGTGAGGCCAGCATCCTGGAGGCCAGACCCCTCAGTGACAAGGGCTCTGGAGACAGCTCTCAGATTACTCAAGTCAGTCCCCAGAGGATTGCGCTCCGGCTCCGGCCAGATGATTCGAAGAGTTTCTCCGTCCAGGTCCGGCAGGTGGAGGATTACCCTGTGGATATCTACTACTTGATGGACCTGTCTTACTCCATGAAAGATGACCTGTGGAGCATCCAGAACCTGGGTACCAAGCTGGCTTCCCAGATGCGCAAGCTCACCAGTAACTTACGGATTGGCTTTGGGGCCTTTGTGGACAAACCCGTGTCACCATACATGTACATCTCCCCACCAGAGGCCCTCAAAAACCCCTGCTATGATATGAAGACCACCTGTTTGCCCATGTTCGGCTACAAACATGTGCTCACACTGACTGACCAGGTGACCCGCTTCAATGAGGAGGTGAAGAAGCAGAGTGTGTCACGGAACCGAGATGGCCCAGAGGGCGGCTTTGATGCCATCATGCAGGCGACAGTCTGTGATGAGAAGATTGGCTGGAGGAATGATGCATCCCACTTGCTGGTGTTTACCACTGATGCCAAGACCCATATAGCACTGGATGGAAGGTTGGCAGGCATTGTCCAGCCCAATGATGGGCAGTGTCACGTTGGCAGTGACAACCATTACTCTGCCTCTACTACCATGGATTATCCCTCTCTGGGGCTGATGACTGAGAAGTTATCCCAGAAAAACATCAATTTGATCTTTGCAGTGACTGAAGAAGTAGTCAATCTCTACCAGAACTACAGTGAGCTCATCCCAGGGACCACAGTGGGAGTTCTGTCCACCGATTCCAGCAATGTCCTACAGCTCATTGTTGATGCTTATGGGAAAATCCGCTCCAAAGTAGAGCTGGAAGTGCGTGACCTTCCTGAGGAGTTGTCTCTGTCCTTCAATGCTACTTGTCTCAACAACGAGGTCATCCCAGGCCTCAAGTCTTGTGTTGGACTCAAGATTGGAGACACGGTGAGCTTCAGCATCGAGGCCAAGGTGCGTGGCTGCCCCCAGGAGAAGGAAAAGTCCTTCGCCATCAAGCCTGTGGGCTTTAAAGACAGTCTCACTGTGCAGGTCACCTTCGACTGTGACTGTGCCTGCCAGGCCCATGCCGAGCCTTACAGCCGCCACTGCAACAACGGCAATGGGACCTTTGAGTGTGGGGTGTGCCGCTGTGGGCCTGGCTGGCTGGGATCCCAGTGTGAGTGCTCAGAAGAGGACTACCGCCCCTCGCAGCAGGATGAGTGCAGCCCCCAAGAGGGCCAGCCAGTCTGCAGCCAGCGGGGCGAGTGCCTCTGTGGCCAGTGCGTCTGCCACAGCAGTGACTTTGGCAAGATCACGGGCAAGTACTGTGAGTGTGATGACTTCTCCTGTGTCCGCTACAAGGGGGAGATGTGCTCGGGACATGGCCAGTGCAGCTGTGGGGACTGCCTGTGTGACTCCGATTGGACCGGCTACTACTGCAACTGTACCACACGCACGGACACCTGCATGTCCAGTAATGGGCTGCTGTGCAGCGGCCGGGGCAAGTGTGAATGTGGCAGCTGCATCTGCATCCAGCCAGGCTCCTACGGGAACACCTGTGAGAAGTGTCCCACCTGCCCTGATGCCTGCACCTTTAAGAAGGAGTGTGTAGAGTGTAAGAAGTTCAACCGGGGAACCCTGCTCGAGGAAAATACCTGCAACAGTTACTGTCGTGATGAGATCGAGTCTGTGAAGGAGCTCAAGGACACTGGCAAGGATGCAGTGAATTGTACCTATAAGAATGAGGATGACTGTGTCATCAGGTTCCAGTACTATGAAGACTCCAGTGGAAAGTCTATCCTATATGTGGTAGAAGAGCCAGAGTGTCCCAAGGGCCCCGACATCCTAGTGGTCCTGCTTTCAGTGATGGGGGCCATTCTGCTCATCGGCCTTGCTACTCTGCTCATCTGGAAGCTCCTCATTACCATTCATGATCGGAAGGAATTTGCAAAATTTGAGGAAGAGCGAGCCAGAGCAAAATGGGACACGGCCAACAACCCACTGTATAAAGAAGCCACATCCACCTTCACCAACATCACCTACCGGGGCACTTAATGGCAAAGTAGTCGTCCTCCGATCACTATCAGACTGTCCCAGGATTGTGGGCATCTCTGCTGTCGTGTTTACAGGAGACAATATCTGTGGGGTGGGATTGGG