Transcript asmbl_24441

Sequence
Transcript Sequence for observation asmbl_24441 of TGE0003332:
CGGATAGCTGCCTGATCCAAGGCCCAGCAGCTTCTGCCTTCCGGATCCCCACCGACGGACGGAGGCAGCCCACCTGCAGGACCGGGGCGCTGTCGGTCCACGTGGCCGCTCTGGAGCAGGTTGGAGTTGGCAGCGGGCTGCGCTGCAGGGACAGGCGCGGCGGACAGCCCCGGGGGCAGCGGCGGGGTCCTGTCTGGGAGAGGACAGGGTTGCGGCGGGCGGAACGGTGTCTCCTTCACTTCGCCCTCCAGCTGCTGGAGCTGCAGCCCGACCGCGAGCGTGCCAAGCGGCTTCAGCAGCTAGCGGAGCGGTGGCGGCGGCCCCCCTCAGGACACCACCAGATTCCCCTCTTCCCGCGGCCTCGCCATGGCGACCCACGGACAGACTTGCGCGCGTCCAATGTGTATTCCTCCATCATATGCTGACCTTGGCAAAGCTGCCAGAGATATTTTCAACAAAGGATTTGGTTTTGGGTTGGTGAAACTGGATGTGAAAACAAAGTCTTGCAGTGGCGTGGAATTTTCAACGTCCGGTTCATCTAATACAGACACTGGTAAAGTTACTGGGACCTTGGAGACCAAATACAAGTGGTGTGAGTATGGTCTGACTTTCACAGAAAAGTGGAACACTGATAACACTCTGGGAACAGAAATCGCAATTGAAGACCAGATTTGTCAAGGTTTGAAACTGACATTTGATACTACCTTCTCACCAAACACAGGAAAGAAAAGTGGTAAAATCAAGTCTTCTTACAAGAGGGAGTGTATAAACCTTGGTTGTGATGTTGACTTTGATTTTGCTGGACCTGCAATCCATGGTTCAGCTGTCTTTGGTTATGAGGGCTGGCTTGCTGGCTACCAGATGACCTTTGACAGTGCCAAATCAAAGCTGACAAGGAATAACTTTGCAGTGGGCTACAGGACTGGGGACTTCCAGCTACACACTAATGTCAATGATGGGACAGAATTTGGAGGATCAATTTATCAGAAAGTTTGTGAAGATCTTGACACTTCAGTAAACCTTGCTTGGACATCAGGTACCAACTGCACTCGTTTTGGCATTGCAGCTAAATATCAGTTGGATCCCACTGCTTCCATTTCTGCAAAAGTCAACAACTCTAGCTTAATTGGAGTAGGCTATACTCAGACTCTGAGGCCTGGTGTGAAGCTTACACTCTCTGCTCTGGTAGATGGGAAGAGCATTAATGCTGGAGGCCACAAGGTTGGGCTCGCCCTGGAGTTGGAGGCTTAATCCAGCTGAAAGAAACCTTTGGGAATGGATATCAGAAGATTTGGCCTTAATATATTTCCATTGTGACCAGCAGCAGGCTTTTTTCCCCCAAGAAGATGATCAAAACAAAGGATGATCTCAACAAGAGCTGTATTTTAAGTATTTAGACAGTTCTTTGTTAGCTGGTTTCTAGTTGGTTATCTAGTTACCAATGCTGCAGTCCTGCAGTCACCTATACATTATTTAAATGTATTTAACTGTTAAATGCGCTACCCACCAATAATGAAATAGACCTTTATGAAAACTGTGCAATTGTGTGCATGTTTGTTTTTATGTTCCTTTAGAAAACATTGACTGTTACCATTGAATGAGATGGATCAGTGGATATTAAGATGAGGTTACAAATTTTGTTAAGTTCAGCCATTATTACTTTTGGTATCCCAGAACATGACAAATTATGAATAAAACAAGTATACATA