Transcript asmbl_24429

Sequence
Transcript Sequence for observation asmbl_24429 of TGE0057962:
GGGAGCCCGTGAGGCTGGTTACGCCGAGGGAAGCCCCGACTCCGTAGTCGCTGCACAGTCTGTCTCTTCGCCGGTTCCCGGCCCCGTGGATCCTACTTCTCTGTCGCCCGCGGTTCGCCGCCCCGCTCGCCGCCGCGATGCCAGTGTTTCATACGCGCACGATCGAGAGCATCCTGGAGCCGGTGGCACAGCAGATCTCCCACCTGGTGATAATGCACGAGGAGGGCGAGGTGGACGGCAAAGCCATTCCTGACCTCACCGCGCCCGTGGCCGCCGTGCAGGCGGCCGTCAGCAACCTCGTCCGGGTTGGAAAAGAGACTGTTCAAACCACTGAGGATCAGATTTTGAAGAGAGATATGCCACCAGCATTTATTAAGGTTGAGAATGCTTGCACCAAGCTTGTCCAGGCAGCTCAGATGCTTCAGTCAGACCCTTACTCAGTGCCTGCTCGAGATTATCTAATTGATGGGTCAAGGGGCATCCTCTCTGGAACATCAGACCTGCTCCTTACCTTCGATGAGGCTGAGGTCCGTAAAATTATTAGAGTTTGCAAAGGAATTTTGGAATATCTTACAGTGGCAGAGGTGGTGGAGACTATGGAAGATTTGGTCACTTACACAAAGAATCTTGGGCCAGGAATGACTAAGATGGCCAAGATGATTGACGAGAGACAGCAGGAGCTCACTCACCAGGAGCACCGAGTGATGTTGGTGAACTCGATGAACACCGTGAAAGAGTTGCTGCCAGTTCTCATTTCAGCTATGAAGATTTTTGTAACAACTAAAAACTCAAAAAACCAAGGCATAGAGGAAGCTTTAAAAAATCGCAATTTTACTGTAGAAAAAATGAGTGCTGAAATTAATGAGATAATTCGTGTGTTACAACTCACCTCTTGGGATGAAGATGCCTGGGCCAGCAAGGACACTGAAGCCATGAAGAGAGCATTGGCCTCCATAGACTCCAAACTGAACCAGGCCAAAGGTTGGCTCCGTGACCCTAGTGCCTCCCCAGGGGATGCTGGTGAGCAGGCCATCAGACAGATCTTAGATGAAGCTGGAAAAGTTGGTGAACTCTGTGCAGGCAAAGAACGCAGGGAGATTCTGGGAACTTGCAAAATGCTAGGGCAGATGACTGATCAAGTGGCTGACCTCCGTGCCAGAGGACAAGGATCCTCACCGGTGGCCATGCAGAAAGCTCAGCAGGTATCTCAGGGTCTGGATGTGCTCACAGCAAAAGTGGAAAATGCAGCTCGCAAGCTGGAAGCCATGACCAACTCAAAGCAGAGCATTGCAAAGAAGATCGATGCTGCTCAGAACTGGCTTGCAGATCCAAATGGTGGACCGGAAGGAGAAGAGCAGATTCGAGGTGCTTTGGCTGAAGCTCGGAAAATAGCAGAATTATGTGATGATCCTAAAGAAAGAGATGACATTCTACGTTCCCTTGGGGAAATATCTGCTCTGACTTCTAAATTAGCAGATCTACGAAGACAGGGGAAAGGAGATTCTCCAGAGGCTCGAGCCTTGGCCAAACAGGTGGCCACGGCCCTGCAGAACCTGCAGACCAAAACCAACCGGGCTGTGGCCAACAGCAGACCGGCCAAAGCAGCTGTACACCTTGAGGGCAAGATTGAGCAAGCACAGCGGTGGATTGATAATCCCACAGTGGATGACCGTGGAGTCGGTCAGGCTGCCATCCGGGGGCTTGTGGCCGAAGGGCATCGTCTGGCTAATGTTATGATGGGGCCTTATCGGCAAGATCTTCTCGCCAAGTGTGACCGAGTGGACCAGCTGACAGCCCAGCTGGCTGACCTGGCTGCCAGAGGGGAAGGGGAGAGTCCTCAGGCACGAGCACTTGCATCTCAGCTCCAAGACTCCTTAAAGGATCTAAAAGCTCGGATGCAGGAGGCCATGACTCAGGAAGTGTCAGATGTTTTCAGCGATACCACAACTCCCATCAAGCTGTTGGCAGTGGCAGCCACGGCGCCTCCTGATGCGCCTAACAGGGAAGAGGTATTTGATGAGAGGGCAGCTAACTTTGAAAACCATTCAGGAAAGCTTGGTGCTACGGCCGAGAAGGCGGCTGCGGTTGGTACTGCTAATAAATCAACAGTGGAAGGCATTCAGGCCTCAGTGAAGACGGCCCGAGAACTCACACCCCAGGTGGTCTCGGCTGCTCGTATCTTACTTAGGAACCCTGGAAATCAAGCTGCTTATGAACATTTTGAGACCATGAAGAACCAGTGGATCGATAATGTTGAAAAAATGACAGGGCTGGTGGACGAAGCCATTGATACCAAATCTCTGTTGGATGCTTCAGAAGAAGCAATTAAAAAAGACCTGGACAAGTGCAAGGTAGCTATGGCCAACATTCAGCCTCAGATGCTGGTTGCTGGGGCAACCAGTATTGCTCGTCGGGCCAACCGGATCCTGCTGGTGGCTAAGAGGGAGGTGGAGAATTCCGAGGATCCCAAGTTCCGTGAGGCTGTGAAAGCTGCCTCTGATGAATTGAGCAAAACCATCTCCCCGATGGTGATGGATGCAAAAGCTGTGGCTGGAAACATTTCCGACCCTGGACTGCAAAAGAGCTTCCTGGACTCAGGATATCGGATCCTGGGAGCTGTGGCCAAGGTCAGAGAAGCCTTCCAACCTCAGGAGCCTGACTTCCCGCCGCCTCCACCAGACCTTGAACAACTCCGACTAACAGATGAGCTTGCTCCTCCCAAACCACCTCTGCCTGAAGGTGAGGTCCCTCCACCTAGGCCTCCACCACCAGAGGAAAAGGATGAAGAGTTCCCTGAGCAGAAGGCCGGGGAGGTGATTAACCAGCCAATGATGATGGCTGCCAGACAGCTCCATGATGAAGCTCGCAAATGGTCCAGCAAGCCGGGCATCCCAGCCGCTGAG