Transcript asmbl_2122

Sequence
Transcript Sequence for observation asmbl_2122 of TGE0004121:
TAAGTAACATTGTGGTTTCTTCCCTCTGGTAATGGATCAACCTCCAGTGATGACTATGACTCCAAGAAACGCAAACAGCGGGCTGGTGGAGAGCCTTGGGGTGCTAAGAAACCAAGGCATGACCTGCCTCCTTACCGGGTCCATCTTACTCCCTATACCGTGGATAGCCCCACCTGCGACTTCCTAGAACTCCAGCGCCGTTACCGCAGCCTCCTGGTTCCCTCAGATTTTCTGGCTGTTCATCTGAGCTGGCTGTCAGCCTTCCCTCTGAGCCAGCCTTTTTCCCTCCATCACCCAAGCCGTATCCAGGTATCTTCTGAGAAGGAGCCAGCTCCAAACAGTGGTGCTGAGCCCATCCCTGCAGACAGTGACCCTGCTTACAGTTCCAGGGTGCTGCTGCTGTCCTCCCCGGGACTGGAGGAATTGTATCGTTGTTGCATGCTTTTTGTGGATGACATGGCTGAGCCAAGGGAGACTCCAGAACACCCTTTGAAGCAGATTAAGTTTTTGCTGGGCCGGAAAGAAGAGGAGGCAGTGCTTGTTGGGGGTGAGTGGTCTCCTTCCCTGGATGGCCTCGACCCCAAGGGCGACCCGCAGGTGCTAGTCCGCACGGCCATCCGCTGTGCACAGGTGCAGACTGGCATCGACTTGAGCGCCTGCACAAAGTGGTGGCGCTTTGCTGAGTTTCAGTACCTGCAGCCGGGACCCCCGAGGCGGCTCCAGACTGTGGTGGTCTACCTGCCGGATATCTGGACCATTATGCCCACTTTGGAAGAGTGGGAGGCCCTGTGCCAGCAGAAAGCTGCAGAGGCAGCTCCTGCAGCCCAGGAGGTGCCAGTGGAAACAGAGCCTACAGAACAGGCAGCTGACGCGTCAGAGCAAGCAGCAGACGCCTCTAAACAGAACGCAGAGAACCCGGAGGTCACTGCACAGCAGGAAATGGACACCGACCTCCCAGAGGCCCCTCCACCCCCTCTAGAGCCTGCTGTCATGGCACGTTCTGGCTGTGTAAACTTGTCCCTCCATGGTATTGTGGAGGACCGGAGGCCAAAAGAAAGGATCTCTTTTGAGGTGATGGTGCTGGCTGAGCTGTTTCTGGAGATGCTACAGAGGGATTTTGGCTATAGGATTTATAAGATGCTGCTGAGCCTTCCTGAAAAGGTTGTGGCCCCACCTGAACCTGAGAAGGAGGAGGTGGCCAAGGAGGAAGAAGTGGTCAAGGAGGAGGTGGCCAAGGAGTCCAAGGATGAGGTACAGAGTGAGGGCACAGCTGCCGAGTCAGACGCCCCGCCGAAGGAAGATGGGCTTTTGCCCAAACCCCCATCTTCTGGGGGAGAGGAGGAAGAAAAGCCCCGGGGCGAGGCGTCGGAGGACCTCTGTGAGATGGCCCTCGACCCAGAGCTGCTGCTGCTGAGGGACGATGGAGAGGAGGAGTTCGCAGGGGCCAAGCTGGAGGATTCCGAGGTCAGGTCGGTCGCCTCAAACCAGTCAGAGATGGAGTTCTCTTCCCTTCAGGACATGCCCAAGGAGCTGGACCCCTCAGCCGTGCTCCCTTTGGACTGTCTTCTTGCGTTTGTCTTCTTCGATGCCAACTGGTGTGGCTACTTGCACCGGCGAGACTTGGAAAGGATCCTGCTCACTCTCGGGCTCCGGCTCAGCGCAGAGCAGGCCAAACAGCTGGTCAGCAGGGTGGTGGCCCAGAACATCTGCCAGTACCGCAGCCTTCAGTACAGCCGCCCGGAGGGCACGGATGGCGGGCTTCCCGAGGAGGTGCTCTTTGGAAACCTGGACCTGTTACCTCCTTCTGGGAAGAGCGCGAAGCCAGGAGCTGCCCCTGTGGAACACAAAGGCCTGGTGTCCCACAATGGCAGCCTGATCAATGTGGGGAACCTGTTGCAACGCGCAGAGCAGCAGGACAGTGGACGGCTCTACCTGGAGAACAAGATTCACACACTGGAACTGAAGCTGGAGGAGAGCCACCACCGTTTCTCAGCCACTGAAGTCACAAACAAGACACTGGCAGCTGACATGCAGGAGCTGCGCACCCGGCTGGCTGAGGCTGAGGACACGGCCCGGACAGCTGAACGACAGAAGAACCAGCTTCAGCGGCTGCTGCAGGAGTTTCGAAGGCGCCTGACCCCCCTGCAGCTGGAGATGCAGCGAATGGTTGAAAAGGCTGACAGCTGGGTAGAGAAGGAGGAGCCAGCACCTAGCAACTGAGGGGCCTGGCGCAGGAGTTGCCTTCCTGCGAGGTCAGCAGTGGAGCGTGCTGGAGTTAGAGCCCTTTGGTTCCAGAAAGAAGCTGGAGCAGGACCTGGGAGCCATAGGCGGGGTGGCTGACCCTGTGCTCAGCCCATGTAGGGGCACTCAGGCTGTCCGGGTGGGGTTTGCCTGTGCTGCGTGGGATGGACGGGTGAGGAACCGGTTCCACTTAAACTAAATCTAACATCTTCTGCACCCCTCGAATGTCATTTTTGCCCTCTACCTTGGGGTTTCTCCTGGGGCCCTTTAGTCTTGTGCTCTCTCCTGTCCTCTTCCAGTTTAGAGTAAGACGGGAGGAAAAGGCTTTTCGACTATGTCATAAGGTCTGATGCCAATAAACGGAAGAAACAGATGCGAGATCTGGCTGGGGTAAGAGCCCCTTCGTCTGGACGGCACAAGTCCTGCCAGGTTACAGGAGCAGGTTCTCGAGGGAAGGGTCTCTCGTGGCCTTTGCAGGAATGGACTCAGTGCTAGTGAGCTCTCACTGTTGGGCTGTTGCCAGTGGACACTGTTCCAGCCACCCCAGACTTGCCAGAAGAAACCAGCACCTCTGCCCCCTGGCTCCCCGTGTTCAGAATGTGGTATTGGCTCTGGCCCAGCCTTTTTCCCTGTTCCCCATAAGTCTCGCCTCTTTCCATACTGTGGTTTCAGTTTGACTTTGTATATAAAGTTTGTTTTTTTTT