Transcript asmbl_214046

Sequence
Transcript Sequence for observation asmbl_214046 of TGE0056970:
GTAAGTTAGAGTGGTAAATTTAGATATTTAATTTCAGCATAGTTATACTTAACCATGGATTCGGAAGCACAGTTACCTAGTTCTTTAAGGTTCTAACCACTGTTTTCTCATTACATCTATGATTGGGATTGCAGTGTTTATCCACTTTGTTGCAATTTAATCAATTTTATCAAATTTCCTATTTTTATACATTAGTCATCTTGGTGTATATTGTTTGCAGATGTGGTGCTCTGGGGACAAATTTTTAATTTGAACGTAAACATCGAGATTGCTGCTGTCAATAAAGAATATGGTCTGATTGAAATGTACTAATATTTAAACTGAACTGTTTAATGCCTAAATTTTATATATAATTCTACTTTAAAAATAAGCCTTATGTCTTTTATACCAAATATGAGTAGTTTTCTAAAGCAATGAAATTAGAAAACTATATAATTTCAGTATCTGATTATACTGCTTGTTATTTGAGAAGTACAAACCTCAAAGATTGGAAACATGAATATATTATTTTAAAAGTAATTTTACTTCTGTTTTCTGTTAGCACACAGTCCTCTGTGTTTTGATCTTTGTGATTTCTCCCCTGTGTATAAGATTACTAACCCTATGCTTTAAGAAGTTATTGATGAATTCAGTAAATTTTATTTTAATCCCTCTAGATCTGGAAGGGTAAGATAATGTTTCAAAATATTTGGTACACTTTGTATGTGAAGGGAAGAAGCTCTAAAAGATGGTTGGGTTTAGGGATGAGTTGTACGATGACCTAAAGTCAGGTAATATCACATTTTTTAACCTAGCATGTTACTTATTGGAAGTCCTGATTCTAATCTTTTTTTTTGTAGCCCCTGGATGAAACACTGAAGAAAGCCCTTACAGGTCACCTTGAGGAGGTTGTTTTAGCTCTGCTAAAAACTCCAGCGCAATTTGATGCTGATGAACTTCGTGCTGCCATGAAGGGCCTTGGAACTGATGAAGATACTCTAATTGAGATTTTGGCATCAAGAACTAACAAAGAAATCAGAGACATTAACAGGGTCTACAGAGAGGAACTGAAGAGAGATCTGGCCAAAGACATAACCTCAGACACATCTGGAGATTTTCGGAACGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGACTTTGGTGTGAATGAAGACTTGGCTGATTCAGATGCCAGGGCCTTGTATGAAGCAGGAGAAAGGAGAAAGGGGACAGACGTAAACGTGTTCAATACCATCCTTACCACCAGAAGCTATCCACAACTTCGCAGAGTGTTTCAGAAATACACCAAGTACAGTAAGCATGACATGAACAAAGTTCTGGACCTGGAGTTGAAAGGTGACATTGAGAAATGCCTCACAGCTATCGGTATGTAGTCCAGCAGTTGAAAGAGTTTTCTAACTAGAAATTGTATTTTCAAAGCTATCCTATACTTAACAAGAACAACAGCAACAAAACCAATAAAAGAAAACAAAAAACAATCAGAAGTAGTGCATCTGTTTCAATTGAAGCAACGTAAAAGATTGGCAAAGTACTATAACCTTAATAACAATAGATATTATTCCCCTTTTCAAAAATAGAGAGAGATAGACTATACTTATTGAGCACCTACTTATATCAAACAATGTACCAGGCTGGGCACACCACAGAGGCAATTCAGAATGGTCACTGAGAGCATGGGATCTGGAATAAATGTAACATCTGGATAAATGTAACTTCAAGTCCTGGTCTACTGCTTGTTAATTGTACAATCTTGGGCAGGTCCAGGAGAGTCTGATTCAGTGGGTCCGAGTTGGCCTCTAAAAATCGGTACTTTTTAAAGATCTCCCAGGTTATTCAGACAACCATCAGGGTTGGGGAACCTATGTTCTCAAGCAGTGTTTCTCATTCATGACTATGCACTTGAATCCCCTGGAAAGCTTGTTAAAATGCAGATTCTGATTCCCCAGGTCTGGGGTGGAGCTTAGATTCTGCTTTTCTAACAAGCTCCCCATTGATGCCAATGCTGTTGGTCCATAGATCTCGACAAGATGAAGAACACTATGAACTGGAATGTGCTAGTATTATTTGGGTTCTGTTTTATATTTAAGCCCATCCTATCCCAGAGTTTTTTCTTCATTTATTCATTTATTTTTACTTATTTGTTTGTGCAACTCTTACTTTAGACACAGAGGTACATGTGCACGTTTGTTCCATGGGTGTTCTGCACTCAGGCAGTGAGCATAGTACCCAATAAGTAGTTTTTTGACCAATGCCCCTTCTCTCCCTGCCCTCTCTAGTAGTCTGCAGTGTCTGTTGTTCATAGGGTGTTCTTTTTAAATGTTCTTATAGTAACATAAATAAAGTATTTACATAGGCTTGAACACCTAGTGGCTTCTCCACTCCCAAGGAGAATATATGTTGGATAGCGCAAACTACTGAAGTTGCTCTTGAGATGTATTTAAGGTAATAAAAAAATTGATCGTCAGGGAAAAGAATATTCAAAACCACCATCTAGAGAGTCACAAATACCTTCTCAGAAGTTAACTGCCCTATATTGGGAGATGAGAGGTGAAGAATGATGATGAGGGATAGAACACTGTTGGCAAAATTCTATATTTCCTGTTTCTTTCATATGGATATTTCATTTTTTTCATGGTAAATACATCAACTAAAATTTTCTTCTCTAACAGTGAAGTGCGCCACAAGCAAACCAGCTTTCTTTGCAGAGAAGCTTCATCAAGCCATGAAAGTATGTACCATTCTACTTATATGTCCTGCTTAGAGGAAGAATTATTTGTAGAAAGAACAGAAAACCTCATGTTGTTTGAAAATCTCACATTTAATATCTTCCCATTAATGAGAATCATTGTTCTATTTGATGAAAGAGGTAATACACTACCTTCTCAGAATAAACTTCTGTTAGATTCGGTGCTTTTTTTTACAGATGAGATTGTAAAGTGAGCCTGTAAGTGATTTACGGCTCACTTGTGATTTGCTTAAAACATGTGTCACCACGGGAAGGGTGATGTACTTTCTTTTTTAACGTGTAATTTTAGTGGCCTACTTCCTCTAAGGTTGTGAGTTTTATAATCTCCCACTTTATGAGTCTGATTTGTTGTTTTTATTATTCTGTCTTTTATGCCACAGATTAATAGTTGAAACTTTTGAAATGTCATTCTATGATTAAGGATGTAGAATGATGTATTTGAGATCAACTATGTCACTTTAACTTTACTGTCTGACATGCATGGTATTATACAAGGTACCTCTTCTATTCTGACATTTTGAGCCCACAAATGAATAGTTATGAAGTTATCTTCCTTTTTTCTTTGCAGCTCCAAAATAAGGAGGTTTTCAGAGAGAGAGAGAAAGAAAGATCTAACTATTTGAATAATATGAAGGAATATTTTGAATATATATGAATAATTTGAATAATATGAAATGATAGACATGCTAGGTACTGCTCTGTAGTGGTTAGCATAGTTGCTGCCCCCTTTCTGCCATAGTCTAGTGTGATATTTCGTTGGGTAATGATGAATACCTGGTGCCATGGAAGAGAAAAGTGGGACATATACTCCAGACTTTGGAAATCCAGGTAGCATTGCTGTCAGCTAAATTAACACCTGAAGTTTAAATAGAAATGAGCCAGATGAGGGCAAGAGTGGAAGAGATGGGGATAAAGCAAGGGTGGTCCAAGAGGAAGAAGTAACCCACACACAGGCTTGAAGGCAAAAGGTAACATAACCTTCTCAAGACAGTAAGTATAGAGTGATGGTGCACACTGGAAGAGATGGTAGAATTAGGCAGGATATTGTAAGCCTTGAAAAAGAATTAGGCAGGATATCGGAAGCCCTGATTAGATTCTATCCTAAGAGCAACAGAAGATCACTGACAGTGTTTTAAATAGATAGACTAGTTTATTAGATTTGCAGTTTAGAAGTTCCCTTTTTTTGTAATTATTGGACAGTGTAGAGACCGGATGGTGAGAGATGAGTTAGGAAGTTGTGACAGCTCTCTATACCTACCGCTAATGTAGAGGATTATTTATTTTCATTTCATTACCATTCGTGTAAGGTGTGTGTGTGTGTGTGTGT