Transcript asmbl_204779

Sequence
Transcript Sequence for observation asmbl_204779 of TGE0056441:
CAGCTATTCGTGGTGATGATGCGCCCCCCGGCGCCCCCAGCCCGGTGCTGCACCGGCCCCCACCTCCCGGCTTCCAGAAAGCTCCCCTTGCTTTCCGCGGCATTCTTTGGGCGTGAGTCATGCAGGTTTGCAGCCAGCCCCAAAGGGGGTGTGTGCGCGAGCAGAGCGCTATAAATACGGCGCCTCCCAGTGCCCACAACGCGGCGTCGCCAGGAGGAGCGCGCGGGCACAGGGTGCCGCTGACCGAGGCGTGCAAAGACTCCAGAATTGGAGGCATGATGAAGACTCTGCTGCTGTTTGTGGGGCTGCTGCTGACCTGGGAGAGTGGGCAGGTCCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAGGAAATGTCCAATCAGGGAAGTAAGTACGTCAATAAGGAAATTCAAAATGCTGTCAACGGGGTGAAACAGATAAAGACTCTCATAGAAAAAACAAACGAAGAGCGCAAGACACTGCTCAGCAACCTAGAAGAAGCCAAGAAGAAGAAAGAGGATGCCCTAAATGAGACCAGGGAATCAGAGACAAAGCTGAAGGAGCTCCCAGGAGTGTGCAATGAGACCATGATGGCCCTCTGGGAAGAGTGTAAGCCCTGCCTGAAACAGACCTGCATGAAGTTCTACGCACGCGTCTGCAGAAGTGGCTCAGGCCTGGTTGGCCGCCAGCTTGAGGAGTTCCTGAACCAGAGCTCGCCCTTCTACTTCTGGATGAATGGTGACCGCATCGACTCCCTGCTGGAGAACGACCGGCAGCAGACGCACATGCTGGATGTCATGCAGGACCACTTCAGCCGCGCGTCCAGCATCATAGACGAGCTCTTCCAGGACAGGTTCTTCACCCGGGAGCCCCAGGATACCTACCACTACCTGCCCTTCAGCCTGCCCCACCGGAGGCCTCACTTCTTCTTTCCCAAGTCCCGCATCGTCCGCAGCTTGATGCCCTTCTCTCCGTACGAGCCCCTGAACTTCCACGCCATGTTCCAGCCCTTCCTTGAGATGATACACGAGGCTCAGCAGGCCATGGACATCCACTTCCATAGCCCGGCCTTCCAGCACCCGCCAACAGAATTCATACGAGAAGGCGACGATGACCGGACTGTGTGCCGGGAGATCCGCCACAACTCCACGGGCTGCCTGCGGATGAAGGACCAGTGTGACAAGTGCCGGGAGATCTTGTCTGTGGACTGTTCCACCAACAACCCCTCCCAGGCTAAGCTGCGGCGGGAGCTCGACGAATCCCTCCAGGTCGCTGAGAGGTTGACCAGGAAATACAACGAGCTGCTAAAGTCCTACCAGTGGAAGATGCTCAACACCTCCTCCTTGCTGGAGCAGCTGAACGAGCAGTTTAACTGGGTGTCCCGGCTGGCAAACCTCACGCAAGGCGAAGACCAGTACTATCTGCGGGTCACCACGGTGGCTTCCCACACTTCTGACTCGGACGTTCCTTCCGGTGTCACTGAGGTGGTCGTGAAGCTCTTTGACTCTGATCCCATCACTGTGACGGTCCCTGTAGAAGTCTCCAGGAAGAACCCTAAATTTATGGAGACCGTGGCGGAGAAAGCGCTGCAGGAATACCGCAAAAAGCACCGGGAGGAGTGAGATGTGGATGTTGCTTTTGCACCTACGGGGGCATCTGAGTCCAGCTCCCCCCAAGATGAGCTGCAGCCCCCCAGAGAGAGCTCTGCACGTCACCAAGTAACCAGGCCCCAGCCTCCAGGCCCCCAACTCCGCCCAGCCTCTCCCCGCTCTGGATCCTGCACTCTAACACTCGACTCTGCTGCTCATGGGAAGAACAGAATTGCTCCTGCATGCAACTAATTCAATAAAACTGTCTTGTGAGCTGATCGCTTGGAGGGTCCTCTTTTTATGTTGAGTTGCTGCTTCCCGGCATGCCTTCATTTTGCTATGGGGGGCAGGCAGGGGGGATGGAAAATAAGTAGAAACAAAAAAGCAGTGGCTAAGATGGTATAGGGACTGTCATACCAGTGAAGAATAAAAGGGTGAAGAATAAAAGGGATATGATGACAAGGTTGATCCACTTCAAGAATTGCTTGCTTTCAGGAAGAGAGATGTGTTTCAACAAGCCAACTAAAATATATTGCTGCAAATGGAAGC