Transcript asmbl_11113

Sequence
Transcript Sequence for observation asmbl_11113 of TGE0000086:
GGTGGTGCTGGGGAACTTGGCCGAGAGGGGGAAGGGCTCTGCGGGGCTGGGAGGGGCTGCGTGAGAGGCTCGAGAACGTCGCACCTCGTCTGGGCCCCCCGCCAGATTGAGGCCGGCGCTGCAGGCAGCGGCGGCTGCGCGGTGAACGAGGCGGCCTGCGCGGCGGAGTGCTGAGTCCCGATCCCCGGCTCTGTCCGGCCCACGGATCCTCAAGCCCGGGCCCCGGGCCCGGCCCCAGCCTCAGCCCTGAGCGTCTCGGGGCGGATGGCGCGGGGCGGCGGGGGCGGGCGGTGCTGAGCCCTGCGCGGGCCATGGCCTCGGCCTGCGGGGCGCCGGGCCCGGGGGGCGCCCTGGGCAGCCAGGCCCCCTCCTGGTACCACCGCGACCTGAGCCGGGCGGCCGCGGAGGAGCTGCTGGCCCGGGCGGGCCGCGATGGCAGCTTCCTGGTCCGAGACAGCGAGAGCGTGGCGGGGGCCTTCGCGCTCTGCGTCCTGTATCAGAAGCATGTGCACACGTATCGCATTCTGCCTGATGGAGAAGATTTCTTGGCTGTGCAGACCTCGCAGGGTGTGCCTGTGCGCCGCTTCCAGACCCTGGGTGAGCTCATCGGCCTGTACGCCCAGCCCAACCAGGGCCTTGTGTGCGCCCTGCTTCTTCCTGTAGAGGGTGAGCGAGAGCCGGACCCACCGGATGACCGGGATGCCTCAGATGGGGAGGATGAGAAGCCCCCGCTGCCCCCGCGCTCTGGCTCCACCAGCATTTCTGCCCCCACTGGGCCCAGCAGTCCCCTGCCAGCTCCTGAGACTCCCACAGCTCCAGCTGCTGAGAGTGCTCCCAATGGGCTGAGCACCGTCTCGCACGACTACCTGAAAGGCAGCTATGGGCTGGACCTGGAAGCTGTGAGGGGTGGAGCCAGCCACCTGCCCCACCTCACCCGTACCCTCGCTACCTCATGCCGGAGGCTGCACAGTGAGGTGGACAAGGTCCTGTCAGGCCTGGAGATCCTGTCCAAGGTGTTTGACCAGCAGAGCTCGCCCATGGTGACCCGCCTTTTGCAGCAGCAGAACCTGCCACAGACAGGGGAGCAGGAACTAGAGAGCCTGGTGCTGAAGCTGTCAGTGCTAAAGGACTTCCTGTCAGGCATCCAGAAGAAGGCCCTGAAGGCCCTACAGGACATGAGCTCCACAGCACCCCCAGCTCCGCAGCCATCCACACGTAAGGCCAAGACCATCCCCGTGCAGGCCTTTGAGGTGAAGCTAGATGTGACCCTGGGTGACCTGACCAAGATTGGGAAGTCACAGAAGTTCACGCTGAGCGTGGATGTGGAGGGTGGGCGGCTGGTGCTGCTGCGGAGACAGCGGGACTCCCAGGAGGACTGGACCACCTTCACGCACGACCGCATCCGCCAGCTCATTAAGTCCCAGCGTGTCCAGAACAAGCTGGGTGTTGTGTTTGAGAAGGAGAAGGACCGGACTCAGCGCAAGGACTTCATCTTTGTCAGTGCCCGGAAGCGGGAGGCCTTCTGCCAGCTGTTGCAGCTCATGAAGAACAAGCACTCCAAGCAGGACGAGCCCGACATGATCTCAGTCTTCATAGGCACCTGGAACATGGGAAGTGTACCACCTCCAAAAAACGTGACATCCTGGTTCACATCGAAGGGTCTGGGGAAGACCCTGGACGAGGTCACAGTGACCATACCCCATGACATCTATGTCTTTGGGACCCAGGAGAACTCAGTGGGCGACCGCGAGTGGCTGGACCTACTGCGCGGGGGCCTCAAGGAGCTTACGGATCTGGATTACCGCCCGATTGCCATGCAATCACTGTGGAATATCAAGGTGGCAGTGCTGGTCAAGCCAGAGCACGAGAACCGTATCAGCCATGTCAGTACGTCCAGTGTGAAGACTGGCATCGCCAACACCCTGGGGAACAAGGGGGCTGTGGGCGTCTCCTTCATGTTTAATGGCACCTCATTTGGCTTTGTGAATTGTCACCTCACCTCGGGAAATGAGAAGACGGCTCGGAGGAACCAAAACTACTTGGACATCCTGCGGCTGCTCTCGCTGGGCGACCGGCAGCTCAATGCCTTTGACATCTCTCTGCGTTTCACACACCTCTTCTGGTTTGGGGACCTCAACTACCGCCTGGACATGGATATCCAGGAGATCCTGAACTACATCAGCAGGAAAGAGTTTGAGCCCCTCCTCAGGGTGGACCAGCTCAACCTGGAGCGGGAGAAGCACAAGGTCTTCCTTCGATTCAGTGAGGAGGAGATCTCCTTCCCACCCACCTACCGCTATGAGCGGGGTTCCCGGGACACATATGCCTGGCACAAGCAGAAGCCAACTGGGGTCCGGACCAATGTGCCCTCATGGTGTGACCGGATTCTGTGGAAATCCTACCCTGAAACTCACATCATCTGCAATTCTTATGGTTGCACTGATGACATCGTCACCAGCGACCATTCCCCCGTGTTTGGGACATTTGAGGTTGGAGTTACCTCCCAGTTCATCTCCAAGAAAGGGCTCTCAAAGACTTCAGACCAGGCCTACATTGAGTTTGAGAGCATCGAGGCCATTGTGAAGACAGCCAGCCGCACCAAGTTCTTCATCGAGTTCTACTCTACCTGCCTGGAGGAATACAAGAAGAGCTTTGAGAATGATGCCCAGAGCAGTGACAACATCAACTTCCTCAAAGTGCAGTGGTCTTCACGCCAGCTGCCCACGCTCAAACCAATTCTGGCTGATATCGAGTACCTGCAGGACCAGCACCTCCTGCTCACAGTCAAGTCCATGGATGGCTATGAATCCTATGGGGAGTGTGTGGTTGCACTCAAATCCATGATCGGCAGCACGGCCCAACAGTTCCTGACCTTCCTATCCCACCGTGGCGAGGAGACAGGCAATATCAGAGGCTCCATGAAGGTGCGGGTGCCCACGGAGCGCCTGGGCACCCGTGAGCGGCTCTACGAGTGGATCAGCATTGATAAGGATGAGGCAGGAGCAAAGAGCAAAGCCCCCTCTGTGTCCCGAGGGAGCCAGGAGCCCAGGTTATTTGAAGAACCAGAG