Transcript asmbl_181151

Sequence
Transcript Sequence for observation asmbl_181151 of TGE0056403:
AGCGTCACAAAAGCTGAATATTCTTCTGGAGCCCTTGGAGGGGCTCCAAACTGAGAGGGGAGGGAAGACCGCAGGGAAAGGCGGACCTCAGTGTCTGAAAAGCCAGCTTAGAGTGGGAGGGCCTGGGAGTAGAAGGTAAAAAGGGAGTGGTGAGAATGAATGTGAGAAGGAAGCCAGGACAGCGCAGTCCCCAGTCCCGAACGGCCAGGGAGAGGAGGTGGCCTAGCGCTGGCGGGGCTCACCCCAATCCGTCTGCCTTTTGATGCCGTACTCTGCTGGTTGCGCAGCCACCTCGGGATACTGCACACGGAGAGGAGGGAAAATAAGCGAGGCACCGCCGCACCACGCGGGAGACCTACGGAGACCCACAGCGCCCGAGCCCTGGAAGAGCACTACTGGATGTCAGCGGAGAAATGGCTTTGAGCTCAGCCTGGCGCTCGGTTCTGCCTCTGTGGCTCCTCTGGAGCGCTGCCTGCTCCCGCGCCGCGTCCGGGGACGACAACGCTTTTCCTTTTGACATTGAAGGGAGCTCAGCGGTTGGCAGGCAAGACCCGCCTGAGACGAGCGAACCCCGCGTGGCTCTGGGACGCCTGCCGCCTGCGGCCGAGAAATGCAATGCTGGATTCTTTCACACCCTGTCGGGAGAATGTGTGCCCTGCGACTGTAATGGCAATTCCAACGAGTGTTTGGACGGCTCAGGATACTGTGTGCACTGCCAGCGGAACACAACAGGAGAGCACTGTGAAAAGTGTCTGGATGGTTATATCGGAGATTCCATCAGGGGAGCACCCCAATTCTGCCAGCCGTGCCCCTGTCCCCTGCCCCACTTGGCCAATTTTGCAGAATCCTGCTATAGGAAAAATGGAGCTGTTCGGTGCATTTGTAACGAAAATTATGCTGGACCTAACTGTGAAAGATGTGCTCCCGGTTACTATGGAAACCCCTTACTCATTGGAAGCACCTGTAAGAAATGTGACTGCAGTGGAAATTCAGATCCCAACCTGATCTTTGAAGATTGTGATGAAGTCACTGGCCAGTGTAGGAATTGCTTACGCAACACCACCGGATTCAAGTGTGAACGTTGCGCTCCTGGCTACTATGGGGACGCCAGGATAGCCAAGAACTGTGCAGTGTGCAACTGCGGGGGAGGCCCATGTGACAGTGTAACCGGAGAATGCTTGGAAGAAGGTTTTGAACCCCCTACAGGCATGGACTGCCCAACCATAAGCTGTGATAAGTGCGTCTGGGACCTGACTGATGACCTGCGGTTAGCAGCGCTCTCCATCGAGGAAGGCAAATCCGGGGTGCTGAGCGTATCCTCTGGGGCCGCCGCTCATAGGCACGTGAATGAAATCAACGCCACCATCTACCTCCTCAAAACAAAATTGTCAGAAAGAGAAAACCAATACGCCCTAAGAAAGATACAAATCAACAATGCTGAGAACACGATGAAAAGCCTTCTGTCTGACGTAGAGGAATTAGTTGAAAAGGAAAATCAAGCCTCCAGAAAAGGACAACTTGTTCAGAAGGAAAGCATGGACACCATTAACCACGCAAGTCAGCTGGTAGAGCAAGCCCATGATATGAGGGATAAAATCCAAGAGATCAACAACAAGATGCTCTATTATGGGGAAGAGCATGAACTTAGCCCCAAGGAAATCTCTGAGAAGCTGGTGTTGGCCCAGAAGATGCTTGAAGAGATTAGAAGCCGTCAACCATTTTTCACCCAACGGGAGCTCGTGGATGAGGAGGCAGATGAGGCTTACGAACTACTGAGCCAGGCTGAGAGCTGGCAGCGGCTGCACAATGAGACCCGCACTCTGTTTCCTGTCGTCCTGGAGCAGCTGGATGACTACAATGCTAAGTTGTCAGATCTCCAGGAAGCACTTGACCAGGCCCTTAACTATGTCAGGGATGCCGAAGACATGAACAGGGCCACAGCAGCCAGGCAGCGGGACCATGAGAAACAACAGGAAAGAGTGAGGGAACAAATGGAAGTGGTGAACATGTCTCTGAGCACATCTGCGGACTCTCTGACAACACCTCGTCTAACTCTTTCAGAACTTGATGATATAATAAAGAATGCGTCAGGGATTTATGCAGAAATAGATGGAGCCAAAAGTGAACTACAAGTAAAACTATCTAACCTAAGTAACCTCAGCCATGATTTAGTCCAAGAAGCTATTGACCATGCACAGGACCTTCAACAAGAAGCTAATGAATTGAGCAGGAAGTTGCACAGTTCAGATATGAACGGGCTGGTACAGAAGGCTTTGGATGCATCAAATGTCTATGAAAATATTGTTAATTATGTTAGTGAAGCCAATGAAACAGCAGAATTTGCTTTGAACACCACTGACCGAATTTATGATGCGGTGAGTGGGATTGATACTCAAATCATTTACCATAAAGATGAAAGTGAGAACCTCCTCAATCAAGCCAGAGAACTGCAAGCAAAGGCAGAGTCTAGCAGTGATGAAGCAGTGGCTGACACTAGCAGGCGTGTGGGTGGAGCCCTAGCAAGGAAAAGTGCCCTTAAAACCAGACTCAGTGATGCCGTTAAGCAACTACAAGCAGCAGAGAGAGGGGATGCCCAGCAGCGCCTGGGGCAGTCTAGACTGATCACCGAGGAAGCCAACAGGACGACGATGGAGGTGCAGCAGGCCACTGCCCCCATGGCCAACAATCTAACCAACTGGTCACAGAATCTTCAACATTTTGACTCTTCTGCTTACAACACTGCAGTGAACTCTGCTAGGGATGCAGTAAGAAATCTGACCGAGGTTGTCCCTCAGCTCCTGGATCAGCTTCGTACGGTTGAGCAGAAGCGACCTGCAAGCAACGTTTCTGCCAGCATCCAGAGGATCCGAGAGCTCATTGCTCAGACCAGAAGTGTTGCCAGCAAGATCCAAGTCTCCATGATGTTTGATGGCCAGTCAGCTGTGGAAGTGCACTCGAGAACCAGTATGGATGACTTAAAGGCCTTCACGTCTCTGAGCCTGTACATGAAACCCCCTGTGAAGCGGCCGGAACTGACCGAGACTGCAGATCAGTTTATCCTGTACCTCGGAAGCAAAAACGCCAAAAAAGAGTATATGGGTCTTGCAATCAAAAATGATAATCTGGTATACGTCTATAATTTGGGAACTAAAGATGTGGAGATTCCCCTGGACTCCAAGCCCGTCAGTTCCTGGCCTGCTTACTTCAGCATTGTCAAGATTGAAAGGGTGGGAAAACATGGAAAGGTGTTTTTAACAGTCCCGAGTCTAAGTAGCACAGCAGAGGAAAAGTTCATTAAAAAGGGGGAATTTTCGGGAGATGACTCTCTGCTGGACCTGGACCCTGAGGACACAGTGTTTTATGTTGGTGGAGTGCCTTCCAACTTCAAGCTCCCTACCAGCTTAAACCTGCCTGGCTTTGTTGGCTGCCTGGAACTGGCCACTTTGAATAATGATGTGATCAGCTTGTACAACTTTAAGCACATCTATAATATGGACCCCTCCACATCAGTGCCATGTGCCCGAGATAAGCTGGCCTTCACTCAGAGTCGGGCTGCCAGTTACTTCTTCGATGGCTCCGGTTATGCCGTGGTGAGAGACATCACAAGGAGAGGGAAATTTGGTCAGGTGACTCGCTTTGACATAGAAGTTCGAACACCAGCTGACAACGGCCTTATTCTCCTGATGGTCAATGGAAGTATGTTTTTCAGACTGGAAATGCGCAATGGTTACCTACATGTGTTCTATGATTTTGGATTCAGCGGTGGCCCTGTGCATCTTGAAGATACGTTAAAGAAAGCTCAAATTAATGATGCAAAATACCATGAGATCTCAATCATTTACCACAATGATAAGAAAATGATCTTGGTAGTTGACAGAAGGCATGTCAAGAGCATGGATAATGAAAAGATGAAAATACCTTTTACAGATATATACATTGGAGGAGCTCCTCCAGAAATCTTACAATCCAGGGCCCTCAGAGCACACCTTCCCCTAGATATCAACTTCAGAGGATGCATGAAGGGCTTCCAGTTCCAAAAGAAGGACTTCAATTTACTGGAGCAGACAGAAACCCTGGGAGTTGGTTATGGATGCCCAGAAGACTCACTTATATCTCGCAGAGCATATTTCAATGGACAGAGCTTCATTGCTTCAATTCAGAAAATATCTTTCTTTGATGGCTTTGAAGGAGGTTTTAATTTCCGAACATTACAACCAAATGGGTTACTATTCTATTATGCTTCAGGGTCAGACGTGTTCTCCATCTCACTGGATAATGGTACTGTCATCATGGATGTAAAGGGAATCAAAGTTCAGTCAGTAGATAAGCAGTACAATGATGGGCTGTCCCACTTCGTCATTAGCTCTGTCTCACCCACAAGATATGAACTGATAGTAGATAAAAGCAGAGTTGGGAGTAAGAATCCTACCAAAGGGAAAATAGAACAGACACAAGCAAGTGAAAAGAAGTTTTACTTCGGTGGCTCACCAATCAGTGCTCAGTATGCTAATTTCACTGGCTGCATAAGTAATGCCTACTTTACCAGGGTGGATAGAGATGTGGAGGTTGAAGATTTCCAACGGTATACTGAAAAGGTCCACACTTCTCTTTATGAGTGTCCCATTGAGTCTTCACCATTGTTTCTCCTCCATAAAAAAGGAAAAAATTTATCCAAGCCTAAAGCAAGTCAGAATAAAAAGGGAGGGAAAAGTAAAGATGCACCTTCATGGGATCCTGTTGCTCTGAAACTCCCAGAGCGGAATACTCCAAGAAACTCTCATTGCCACCTTTCCAACAGCCCTAGAGCAATAGAGCACGCCTATCAATATGGAGGAACAGCCAACAGCCGCCAAGAGTTTGAACACTTAAAAGGAGATTTTGGTGCCAAATCTCAGTTTTCCATTCGTCTGAGAACTCGTTCCTCCCATGGCATGATCTTCTATGTCTCAGATCAAGAAGAGAATGACTTCATGACTCTATTTTTGGCCCATGGCCGCTTGGTTTACATGTTTAATGTTGGTCACAAAAAACTGAAGATTAGAAGCCAGGAGAAATACAATGATGGCCTGTGGCATGATGTGATATTTATTCGAGAAAGGAGCAGTGGCCGACTGGTAATTGATGGTCTCCGAGTCCTAGAAGAAAGTCTTCCTCCTACTGAAGCTACCTGGAAAATCAAGGGTCCCATTTATTTGGGAGGTGTGGCTCCTGGAAAGGCTGTGAAAAATGTTCAGATTAACTCCATCTACAGTTTTAGTGGCTGTCTCAGCAATCTCCAGCTCAATGGGGCCTCCATCACCTCTGCTTCTCAGACATTCAGTGTGACCCCTTGCTTTGAAGGCCCCATGGAAACAGGAACTTACTTTTCAACAGAAGGAGGATACGTGGTTCTAGATGAATCTTTCAATATTGGATTGAAGTTTGAAATTGCATTTGAAGTCCGTCCCAGAAGCAGTTCCGGAACCCTGGTCCACGGCCACAGTGTCAATGGGGAGTACCTAAATGTTCACATGAAAAATGGACAGGTCATAGTGAAAGTCAATAATGGCATCAGAGATTTTTCCACCTCAGTTACACCCAAGCAGAGTCTCTGTGATGGCAGATGGCACAGAATTACAGTTATTAGAGATTCTAATGTGGTTCAGTTGGATGTGGACTCTGAAGTGAACCATGTGGTTGGACCCCTGAATCCAAAACCAATTGATCACAGGGAGCCTGTGTTTGTTGGAGGTGTTCCAGAATCTCTACTGACACCACGCTTGGCCCCCAGCAAACCCTTCACAGGCTGCATACGCCACTTTGTGATTGATGGACACCCAGTGAGCTTCAGTAAAGCAGCCCTGGTCAGCGGCGCCGTAAGCATCAACTCCTGTCCAGCAGCCTGACATGACAGAGCACAGCTGCCCAAATACAAAGTTCTTTAGAGCACTGAAAGAAACACAAAGCCAGCCAGGAGGAACAGTAACTCTTCCTTCGGGTGGAAGCTTTCATCGAGTTGAACAGGACTTAAACGAATCATCAGGGACCGGATATTTCTTATTTCTCATTTGGATTCTTAACCTTGAATCCAAAGTGTCTGCAATGGACAACAATTGAAGGAGTGGCAAACTTACTTGTATTGAGAGCACACGCAATTCCTACTGGTGAAATTACTGTTTCTGTTTCTAATAAAATAGAAGGGATTCCAAATAAACACTTGCACACATTTTTGAAGTGCGGCTAGATTCTCAGATTCACCTTTCTTCCAGGGAAGATAACTTTCAATCTATATAAAAATCTCTGTCCTAAAACTACCTTTCTTTATTTTGAAGAGACTTACTAACTTACATATAATCTAAATTAGATGATAGATTTGTTTTTAGCCCTTTTGTTTGGTCTATCAGTATAAGAAGAATATTTTAGGTTTATAGCTGAAGTTATCAAGGTTTAATAAAGTAAATTTCTAACAGAATACTAGAAAAATGCAGTATAATTTAATTTTTTCTAAATAAGAAACACAGGAAATCAACTACTTTTTCCCCTTCCTTATCTCCTTAAAAGAAAAATAAAATTGTACATGAGAGGAGGCTTCTGTAGGTTATTATTACCATTATTGTGTGTTCTATGGGAATCATTGAGGATATCACAGCAAAAACAGTAGGACAAAATCATAAAATTCAATTTAAGAGTACACAAGTCCTTTTATTAAAAGTTTGCTCCTAGCCTGGGCAACATAATGAGATCCCATCTCTGCAAAAAAATTTGTACATGGGCATACACCTGTAG