Transcript asmbl_148415

Sequence
Transcript Sequence for observation asmbl_148415 of TGE0057860:
GGGGTTGGGAGAGGGGCGATTGGGCAACCCGGCTGCACAAACACGGGAGGTCAAAGATTGCGCCCAGCCCGCCCAGGCCGGGAATGGAATAAAGGGACGCGGGGCGCCGGAGGCTGCACAGAAGCGAGTCCGACTGTGCTCGCTGCTCAGCGCCGCACCCGGAAGATGAGGCTCGCCGTGGGAGCCCTGCTGGTCTGCGCCGTCCTGGGGCTGTGTCTGGCTGTCCCTGATAAAACTGTGAGATGGTGTGCAGTGTCGGAGCATGAGGCCACTAAGTGCCAGAGTTTCCGCGACCATATGAAAAGCGTCATTCCATCCGATGGTCCCAGTGTTGCTTGTGTGAAGAAAGCCTCCTACCTTGATTGCATCAGGGCCATTGCGGCAAACGAAGCGGATGCTGTGACACTGGATGCAGGTTTGGTGTATGATGCTTACCTGGCTCCCAATAACCTGAAGCCTGTGGTGGCAGAGTTCTATGGGTCAAAAGAGGATCCACAGACTTTCTATTATGCTGTTGCTGTGGTGAAGAAGGATAGTGGCTTCCAGATGAACCAGCTTCGAGGCAAGAAGTCCTGCCACACGGGTCTAGGCAGGTCCGCTGGGTGGAACATCCCCATAGGCTTACTTTACTGTGACTTACCTGAGCCACGTAAACCTCTTGAGAAAGCAGTGGCCAATTTCTTCTCGGGCAGCTGTGCCCCTTGTGCGGATGGGACGGACTTCCCCCAGCTGTGTCAACTGTGTCCAGGGTGTGGCTGCTCCACCCTTAACCAATACTTCGGCTACTCGGGAGCCTTCAAGTGTCTGAAGGATGGTGCTGGGGATGTGGCCTTTGTCAAGCACTCGACTATATTTGAGAACTTGGCAAACAAGGCTGACAGGGACCAGTATGAGCTGCTTTGCCTGGACAACACCCGGAAGCCGGTAGATGAATACAAGGACTGCCACTTGGCCCAGGTCCCTTCTCATACCGTCGTGGCCCGAAGTATGGGCGGCAAGGAGGACTTGATCTGGGAGCTTCTCAACCAGGCCCAGGAACATTTTGGCAAAGACAAATCAAAAGAATTCCAACTATTCAGCTCTCCTCATGGGAAGGACCTGCTGTTTAAGGACTCTGCCCACGGGTTTTTAAAAGTCCCCCCCAGGATGGATGCCAAGATGTACCTGGGCTATGAGTATGTCACTGCCATCCGGAATCTACGGGAAGGCACATGCCCAGAAGCCCCAACAGATGAATGCAAGCCTGTGAAGTGGTGTGCGCTGAGCCACCACGAGAGGCTCAAGTGTGATGAGTGGAGTGTTAACAGTGTAGGGAAAATAGAGTGTGTATCAGCAGAGACCACCGAAGACTGCATCGCCAAGATCATGAATGGAGAAGCTGATGCCATGAGCTTGGATGGAGGGTTTGTCTACATAGCGGGCAAGTGTGGTCTGGTGCCTGTCTTGGCAGAAAACTACAATAAGAGCGATAATTGTGAGGATACACCAGAGGCAGGGTATTTTGCTATAGCAGTGGTGAAGAAATCAGCTTCTGACCTCACCTGGGACAATCTGAAAGGCAAGAAGTCCTGCCATACGGCAGTTGGCAGAACCGCTGGCTGGAACATCCCCATGGGCCTGCTCTACAATAAGATCAACCACTGCAGATTTGATGAATTTTTCAGTGAAGGTTGTGCCCCTGGGTCTAAGAAAGACTCCAGTCTCTGTAAGCTGTGTATGGGCTCAGGCCTAAACCTGTGTGAACCCAACAACAAAGAGGGATACTACGGCTACACAGGCGCTTTCAGGTGTCTGGTTGAGAAGGGAGATGTGGCCTTTGTGAAACACCAGACTGTCCCACAGAACACTGGGGGAAAAAACCCTGATCCATGGGCTAAGAATCTGAATGAAAAAGACTATGAGTTGCTGTGCCTTGATGGTACCAGGAAACCTGTGGAGGAGTATGCGAACTGCCACCTGGCCAGAGCCCCGAATCACGCTGTGGTCACACGGAAAGATAAGGAAGCTTGCGTCCACAAGATATTACGTCAACAGCAGCACCTATTTGGAAGCAACGTAACTGACTGCTCGGGCAACTTTTGTTTGTTCCGGTCGGAAACCAAGGACCTTCTGTTCAGAGATGACACAGTATGTTTGGCCAAACTTCATGACAGAAACACATATGAAAAATACTTAGGAGAAGAATATGTCAAGGCTGTTGGTAACCTGAGAAAATGCTCCACCTCATCACTCCTGGAAGCCTGCACTTTCCGTAGACCTTAAAATCTCAGAGGTAGGGCTGCCACCAAGGTGAAGATGGGAACGCAGATGATCCATGAGTTTGCCCTGGTTTCACTGGCCCAAGTGGTTTGTGCTAACCACGTCTGTCTTCACAGCTCTGTGTTGCCATGTGTGCTGAACAAAAAATAAAAATTATTATTGATTTTAT