Transcript asmbl_25676

Sequence
Transcript Sequence for observation asmbl_25676 of TGE0000886:
CGGCGGGAGGAGAGTCGGCGGCCGGAGCCGTCACCCCGGGCGGGGACCCAGCGCAGGCAACTCCGCGCGGCGGCCCGGCCGAGGGAGGGAGCGAGCGGGCGGGCGGGCAAGCCAGACAGCTGGGCCGGAGCAGCCGCGGGCGCCCGAGGGGCCGAGCGAGATTGTAAACCATGGCTGTGTGGATACAAGCTCAGCAGCTCCAAGGAGAAGCCCTTCATCAGATGCAAGCGTTATATGGCCAGCATTTTCCCATTGAGGTGCGGCATTATTTATCCCAGTGGATTGAAAGCCAAGCATGGGACTCAGTAGATCTTGATAATCCACAGGAGAACATTAAGGCCACCCAGCTCCTGGAGGGCCTGGTGCAGGAGCTGCAGAAGAAGGCAGAGCACCAGGTGGGGGAAGATGGGTTTTTACTGAAGATCAAGCTGGGGCACTATGCCACACAGCTCCAGAACACGTATGACCGCTGCCCCATGGAGCTGGTCCGCTGCATCCGCCATATATTGTACAATGAACAGAGGTTGGTCCGAGAAGCCAACAATGGTAGCTCTCCAGCTGGAAGCCTTGCTGATGCCATGTCCCAGAAACACCTCCAGATCAACCAGACGTTTGAGGAGCTGCGACTGGTCACGCAGGACACAGAGAATGAGTTAAAAAAGCTGCAGCAGACTCAGGAGTACTTCATCATCCAGTACCAGGAGAGCCTGAGGATCCAAG