Transcript asmbl_137259

Sequence
Transcript Sequence for observation asmbl_137259 of TGE0056330:
CTCTCACTCTGGCTGGGAGCAGAAGGCAGCCTCGGTCTCTGGGCGGCGGCGGCGGCCCACTCTGCCCTGGCCGCGCTGTGTGGTGACCGCAGGCCCCAGACATGAGGGCGGCCCGTGCTCTGCTGCCCCTGCTGCTGCAGGCCTGCTGGACAGCCGCGCAGGATGAGCCGGAGACCCCGAGGGCCGTGGCCTTCCAGGACTGCCCCGTGGACCTGTTCTTTGTGCTGGACACCTCTGAGAGCGTGGCCCTGAGGCTGAAGCCCTACGGGGCCCTCGTGGACAAAGTCAAGTCCTTCACCAAGCGCTTCATCGACAACCTGAGGGACAGGTACTACCGCTGTGACCGAAACCTGGTGTGGAACGCAGGCGCGCTGCACTACAGTGACGAGGTGGAGATCATCCAAGGCCTCACGCGCATGCCTGGCGGCCGCGACGCACTCAAAAGCAGCGTGGACGCGGTCAAGTACTTTGGGAAGGGCACCTACACCGACTGCGCTATCAAGAAGGGGCTGGAGCAGCTCCTCGTGGGGGGCTCCCACCTGAAGGAGAATAAGTACCTGATTGTGGTGACCGACGGGCACCCCCTGGAGGGCTACAAGGAACCCTGTGGGGGGCTGGAGGATGCTGTGAACGAGGCCAAGCACCTGGGCGTCAAAGTCTTCTCGGTGGCCATCACACCCGACCACCTGGAGCCGCGTCTGAGCATCATCGCCACGGACCACACGTACCGGCGCAACTTCACGGCGGCTGACTGGGGCCAGAGCCGCGACGCAGAGGAGGCCATCAGCCAGACCATCGACACCATCGTGGACATGATCAAAAATAACGTGGAGCAAGTGTGCTGCTCCTTCGAATGCCAGCCTGCAAGAGGACCTCCGGGGCTCCGGGGCGACCCCGGCTTTGAGGGAGAACGAGGCAAGCCGGGGCTCCCAGGAGAGAAGGGAGAAGCCGGAGATCCTGGAAGACCCGGGGACCTCGGACCTGTTGGGTACCAGGGAATGAAGGGAGAAAAAGGGAGCCGTGGGGAGAAGGGCTCCAGGGGACCCAAGGGCTACAAGGGAGAGAAGGGCAAGCGTGGCATCGACGGGGTGGACGGCGTGAAGGGGGAGATGGGGTACCCAGGCCTGCCAGGCTGCAAGGGCTCGCCCGGGTTTGACGGCATTCAAGGACCCCCTGGCCCCAAGGGAGACCCCGGTGCCTTTGGACTGAAAGGAGAAAAGGGCGAGCCTGGAGCTGACGGGGAGGCGGGGAGACCAGGGAGCTCGGGACCATCTGGAGACGAGGGCCAGCCGGGAGAGCCTGGGCCCCCCGGAGAGAAAGGAGAGGCGGGCGACGAGGGGAACCCAGGACCTGACGGTGCCCCCGGGGAGCGGGGTGGCCCTGGAGAGAGAGGACCACGGGGGACCCCAGGCACGCGGGGACCAAGAGGAGACCCTGGTGAAGCTGGCCCGCAGGGTGATCAGGGAAGAGAAGGCCCCGTTGGTGTCCCTGGAGACCCGGGCGAGGCTGGCCCTATCGGACCTAAAGGCTACCGAGGCGATGAGGGTCCCCCAGGGTCCGAGGGTGCCAGAGGAGCCCCAGGACCTGCCGGACCCCCTGGAGACCCGGGGCTGATGGGTGAAAGGGGAGAAGACGGCCCCGCTGGAAATGGCACCGAGGGCTTCCCCGGCTTCCCCGGGTATCCGGGCAACAGGGGCGCTCCCGGGATAAACGGCACGAAGGGCTACCCCGGCCTCAAGGGGGACGAGGGAGAAGCCGGGGACCCCGGAGACGATAACAACGACATTGCACCCCGAGGAGTCAAAGGAGCAAAGGGGTACCGGGGTCCCGAGGGCCCCCAGGGACCCCCAGGACACCAAGGACCGCCTGGGCCGGACGAATGCGAGATTTTGGACATCATCATGAAAATGTGCTCTTGCTGTGGTGAGACCCAGGCTCTAGCTCCTGAGAGAATGGATCCCGGGGGTCGGGGAGCGAGGCCTGGGTCCCACACATGTCACAGGACAGCACATGGCACTCTGGTCCCCGCCCGCAGCTCCCTGCACCTGCCCGCCCCCTCTGGGGCCTGCTCCAAGCCAGCAGGGTTCCCGGGTGTTGGGCTGGGCCCCGCCCTCTTTCACCCATAACTGAAATAACCAGGAGCAGGCTTGGGGGGGTCCCTGCTCCATCATTCTGGCCCACAGGCCCCACCCTAGCCTGGCTGAGCAACGCCAGCCCTGACCAGCCGCCGGACAGAGCAGCCTTTACGGGGCCATGGGAGGGGGTGGGCTTTTCTGGGGCTGAGACGGGGGGACCCCAACGTGTCAGGTGAGGATGTGGCAGCC