Transcript asmbl_116222

Sequence
Transcript Sequence for observation asmbl_116222 of TGE0056843:
CAGGGCTAAGGGGCCGGCGGCCACTCGGCATCTGGGTTTTAGTCAGGCAGTGCTCCAGGCGCCTGGCTGCCAGGCTACGGGAGAAAAGTCCTCCGCTCGGCCGCACCCGTTAGAGGCGCTCTCCACTGCTGTCCTCTTCAGCTCAAGATGGTGGCCTGCCGGGCGATTGGCATCCTCAGCCGCTTTTCTGCCTTCAGGATCCTCCGCTCCCGAGGTTATATATGCCGCAATTTTACAGGGTCTTCTGCTTTGCTGACCAGAACCCATATTAACTATGGAGTCAAAGGGGATGTGGCAGTTGTTCGAATTAACTCTCCCAATTCAAAGGTAAATACACTGAGTAAAGAGCTACATTCAGAGTTCTCAGAAGTTATGAATGAAATCTGGGCTAGTGATCAAATCAGAAGTGCCGTCCTTATCTCATCAAAGCCAGGCTGCTTTATTGCAGGTGCTGATATCAACATGTTAGCCGCTTGCAAGACCCTTCAAGAAGTAACACAGCTATCACAAGAAGCACAGAGAATAGTTGAGAAACTTGAAAAGTCCACAAAGCCTATTGTGGCTGCCATCAATGGATCCTGCCTGGGAGGAGGACTTGAGGTTGCCATTTCATGCCAATACAGAATAGCAACAAAAGACAGAAAAACAGTATTAGGTACCCCTGAAGTTTTGCTGGGGGCCTTACCAGGAGCAGGAGGCACACAAAGGCTGCCCAAAATGGTGGGTGTGCCTGCTGCTTTGGACATGATGCTGACTGGTAGAAGCATTCGTGCAGACAGGGCAAAGAAAATGGGACTGGTTGACCAACTGGTGGAACCCCTGGGACCAGGACTAAAACCTCCAGAGGAACGGACAATAGAATACCTAGAAGAAGTTGCAATTACTTTTGCCAAAGGACTAGCTGATAAGAAGATCTCTCCAAAGAGAGACAAGGGATTGGTGGAAAAATTGACAGCGTATGCCATGACTATTCCATTTGTCAGGCAACAGGTTTACAAAAAAGTGGAAGAAAAAGTGCGAAAGCAGACTAAAGGCCTTTATCCTGCACCTCTGAAAATAATTGATGTGGTAAAGACTGGAATTGAGCAAGGGAGTGATGCCGGTTATCTCTGTGAATCTCAGAAATTTGGAGAGCTTGTAATGACCAAAGAATCAAAGGCCTTGATGGGACTCTACCATGGTCAGGTCCTGTGCAAGAAGAATAAATTTGGAGCTCCACAGAAGGATGTTAAGCATCTGGCTATTCTTGGTGCAGGGCTGATGGGAGCAGGCATCGCCCAAGTCTCCGTGGATAAGGGGCTAAAGACTATACTTAAAGATGCCACCCTCACTGCGCTAGACCGAGGACAGCAACAAGTGTTCAAAGGATTGAATGACAAAGTGAAGAAGAAAGCTCTAACATCATTTGAAAGGGATTCCATCTTCAGCAACTTGACTGGGCAGCTTGATTACCAAGGTTTTGAAAAGGCCGACATGGTGATTGAAGCTGTGTTTGAGGACCTTAGTCTTAAGCACAGAGTGCTAAAGGAAGTAGAAGCGGTGATTCCAGATCACTGTATCTTTGCCAGTAACACATCTGCTCTCCCAATCAGTGAAATCGCTGCTGTCAGCAAAAGACCTGAGAAGGTGATTGGCATGCACTACTTCTCTCCCGTGGACAAGATGCAGCTGCTGGAGATTATCACGACCGAGAAAACTTCCAAAGACACCAGTGCTTCAGCTGTAGCAGTTGGTCTCAAGCAGGGGAAGGTCATCATTGTGGTTAAGGATGGACCTGGCTTCTATACTACCAGGTGTCTTGCGCCCATGATGTCTGAAGTCATCCGAATCCTCCAGGAAGGAGTTGACCCGAAGAAGCTGGATTCCCTGACCACAAGCTTTGGCTTTCCTGTGGGTGCCGCCACACTGGTGGATGAAGTTGGTGTGGATGTAGCGAAACATGTGGCGGAAGATCTGGGCAAAGTCTTTGGGGAGCGGTTTGGAGGTGGAAACCCAGAACTGCTGACACAGATGGTGTCCAAGGGCTTCCTAGGTCGTAAATCTGGGAAGGGCTTTTACATCTATCAGGAGGGTGTGAAGAGGAAGGATTTGAATTCTGACATGGATAGTATTTTAGCGAGTCTGAAGCTGCCTCCTAAGTCTGAAGTCTCATCAGACGAAGACATCCAGTTCCGCCTGGTGACAAGATTTGTGAATGAGGCAGTCATGTGCCTGCAAGAGGGGATCTTGGCCACACCTGCAGAGGGAGACATCGGAGCCGTCTTTGGGCTTGGCTTCCCGCCTTGTCTGGGAGGGCCTTTCCGCTTTGTGGATCTGTATGGCGCCCAGAAGATAGTGGACCGGCTCAAGAAATATGAAGCTGCCTATGGAAAACAGTTCACCCCATGCCAGCTGCTAGCTGACCATGCTAACAGCCCTAACAAGAAGTTCTACCAGTGAGCAGGCCTCATGCCTCGCTCAGTCAGTGCACTAACCCCAGCTGCCGGCAGTGCTGGTTCTCCAACAGAGTGGTGTCTAGATTTATCAGAGTAACGAGAAGACAAACTCCGGCACTGGGTTTGCTCCCTGATTAAAGTGCCTTCAGCCAAGACCATCTCTCCCTCCTGGTGAAGTGTGACTTCGAATTAGTTTGCACTTCCTGTTGGAAGGTAGAGCCCACTGCTCATTGTATAAGCCCCGAGGCCTAGAGTGGCAGCCAAGAGCCATCTGAAGCCACCTCTCTGCCTGTTCCTCCCAAGAGGCCAGGGTGGCCAGGGGTGGTGAGGGCAGTTCTGCACCCAGCCAAACACATAACAATAAAAACCAAACTCTGTGTCAGCATCTTTGCCCTTCTGGTTTAAACGCCTCCTTCAAAAAGCAATCTGGAAGAAAGCCCTGTGCTTTGGGGGAGTAAGAATGTGTGTGCAGAATTCTAGGCAGCACCTTAGGGAGGGACTGGGATGAGAGAAAGTGGGACCTGGTGGGCTCAACCACACACACCTGTCTGTGCAGATGCTTTGCCCAGGCTTCTCACCACGGTGTACCGGGATATTAAACCTCTTTCCCCAGCCTGGATTTCCTCA