Transcript asmbl_104949

Sequence
Transcript Sequence for observation asmbl_104949 of TGE0057806:
GAGTTCCGTGGGCCATGGACCAGCTGCTTTCAAGGGACGTGCCCGTCAGGAGGGAGGGTGGCCAGCCCCCAGGCAGCCCTGACTGTGTGCTCCCCTCCAGGCTGAAACTGCCGCCAACCGGATCTGTAAGGTGCTGGCTGTCAACCAAGAGAACGAGCACCTGATGGAGGACTACGAGAAGCTGGCCAGCGACCTCCTGGAGTGGATCCGGCGCACCATCCCCTGGCTGGAGGACCGTGTGCCCCAAAAGACTATCCAGGAGATGCAGCAGAAGCTGGAGGACTTCCGCGACTACCGGCGTGTGCACAAGCCGCCCAAGGTGCAGGAGAAGTGCCAGCTGGAGATCAACTTCAACACGCTGCAGACCAAGCTGCGCCTCAGCAACCGGCCCGCCTTCATGCCCTCCGAGGGCAAGATGGTCTCGGACATCAACAATGGCTGGCAGCACTTGGAGCAGGCTGAGAAGGGCTACGAGGAGTGGCTGCTGAATGAGATCCGCAGGCTGGAGCGGCTCGACCACCTGGCAGAGAAGTTCCGGCAGAAGGCCTCCATCCACGAGGCCTGGACTGACGGGAAGGAAGCCATGCTGAAGCACCGGGACTACGAGACGGCCACACTATCGGACATCAAAGCCCTCATTCGCAAGCACGAGGCCTTCGAGAGCGACCTGGCTGCGCACCAGGACCGCGTGGAGCAGATCGCCGCCATTGCCCAGGAGCTCAACGAGCTGGATTACTACGACTCCCACAATGTCAACACCCGGTGCCAGAAGATCTGTGACCAGTGGGACGCCCTCGGCTCTCTGACACATAGTCGCAGGGAAGCCCTGGAGAAAACAGAGAAGCAGCTGGAGGCCATCGACCAGCTGCACCTGGAATACGCCAAGCGCGCGGCCCCCTTCAACAACTGGATGGAGAGCGCCATGGAGGACCTCCAGGACATGTTCATCGTCCATACCATCGAGGAGATTGAGGGCCTGATCTCAGCCCATGACCAGTTCAAGTCCACCCTGCCGGACGCCGATAGGGAGCGCGAGGCCATCCTGGCCATCCACAAGGAGGCCCAGAGGATCGCTGAGAGCAACCACATCAAGCTGTCGGGCAGCAACCCCTACACCACCGTCACCCCGCAAATCATCAACTCCAAGTGGGAGAAGGTGCAGCAGCTGGTGCCAAAACGGGACCATGCCCTCCTGGAGGAGCAGAGCAAGCAGCAGTCCAACGAGCACCTGCGCCGCCAGTTCGCCAGCCAGGCCAATGTTGTGGGGCCCTGGATCCAGACCAAGATGGAGGAGATCGGGCGCATCTCCATTGAGATGAACGGGACCCTGGAGGACCAGCTGAGCCACCTGAAGCAGTATGAACGCAGCATCGTGGACTACAAGCCCAACCTGGACCTGCTGGAGCAGCAGCACCAGCTCATCCAGGAGGCCCTCATCTTCGACAACAAGCACACCAACTATACCATGGAGCACATCCGCGTGGGCTGGGAGCAGCTGCTCACCACCATTGCCCGCACCATCAACGAGGTGGAGAACCAGATCCTCACCCGCGACGCCAAGGGCATCAGCCAGGAGCAGATGCAGGAGTTCCGGGCGTCCTTCAACCACTTCGACAAGGATCATGGCGGGGCGCTGGGGCCCGAGGAGTTCAAGGCCTGCCTCATCAGCCTGGGCTACGACGTGGAGAACGACCGGCAGGGTGAGGCCGAGTTCAACCGCATCATGAGCCTGGTCGACCCCAACCATAGCGGCCTTGTGACCTTCCAAGCCTTCATCGACTTCATGTCGCGGGAGACCACCGACACGGACACGGCTGACCAGGTCATCGCTTCCTTCAAGGTCTTAGCAGGGGACAAGAACTTCATCACAGCTGAGGAGCTGCGGAGAGAGCTGCCCCCCGACCAGGCCGAGTACTGCATCGCCCGCATGGCGCCATACCAGGGCCCTGACGCCGTGCCCGGTGCCCTCGACTACAAGTCCTTCTCCACGGCCTTGTATGGCGAGAGCGACCTGTGAGGCCCCAGAGACCTGACCCAACACCCCCGACGGCCTCCAGGAGGGGCCTGGGCAGCCCCACAGTCCCATTCCTCCACTCTGTATCTATGCAAAGCACTCTCTGCAGTCCTCCGGGGTGGGT