Transcript asmbl_101369

Sequence
Transcript Sequence for observation asmbl_101369 of TGE0056581:
GGCGAGCGGCGGGGCGGGGGCGGGGGCGCGGAGGGTCGGCCCCGGGACGCGCGCAGCCGGCCCGCAGTTGCCGCTGTCGTCCGCAGAGCCAGTTCCTAGCGCAGAGCCGCGCCCGCCATGAGGGAGATCGTGCACATCCAGGCGGGCCAGTGCGGGAACCAGATCGGCACCAAGTTTTGGGAAGTGATCAGCGATGAGCACGGCATCGACCCGGCCGGAGGCTACGTGGGAGACTCGGCGCTGCAGCTGGAGAGAATCAACGTCTACTACAATGAGTCATCGTCTCAGAAATATGTGCCCAGGGCCGCCCTGGTGGACTTAGAGCCAGGCACCATGGACAGCGTGCGGTCTGGGCCTTTTGGGCAGCTTTTCCGGCCTGACAACTTCATCTTTGGCCAGACGGGTGCAGGGAACAACTGGGCGAAAGGGCACTACACGGAGGGCGCGGAGCTGGTGGACGCAGTGCTGGACGTGGTGCGGAAGGAGTGCGAGCACTGCGACTGCCTGCAGGGCTTCCAGCTCACGCACTCGCTGGGCGGCGGCACGGGCTCAGGCATGGGCACGCTGCTCATCAGCAAGATCCGTGAGGAGTTCCCGGACCGCATCATGAACACCTTCAGCGTCATGCCCTCGCCCAAGGTGTCGGACACGGTGGTGGAGCCCTACAATGCCACACTGTCGGTGCACCAGCTGGTGGAGAATACAGACGAGACCTACTGCATCGACAACGAGGCGCTCTATGACATCTGCTTCCGCACTCTGAAGCTGACAACGCCCACCTACGGGGACCTCAACCACCTGGTGTCCGCCACCATGAGTGGGGTCACCACCTCGCTGCGCTTCCCGGGCCAGCTCAATGCTGACCTGCGCAAGCTGGCGGTGAACATGGTGCCCTTCCCGCGCCTGCACTTCTTCATGCCTGGCTTCGCGCCGCTCACCAGCCGCGGCAGCCAGCAGTACCGGGCCCTGACCGTGCCCGAGCTCACCCAGCAGATGTTCGACGCCAGGAACATGATGGCCGCCTGCGATCCGCGCCATGGCCGCTACCTGACCGTGGCCACCGTGTTCCGCGGGCCCATGTCCATGAAGGAGGTGGACGAGCAGATGCTGGCCATCCAGAGTAAGAACAGCAGCTACTTCGTGGAGTGGATTCCCAACAACGTGAAGGTGGCCGTGTGCGACATCCCGCCCCGCGGCCTGAAGATGGCCTCCACCTTCATCGGCAACAGCACGGCCATCCAGGAGCTGTTCAAGCGCATCTCCGAGCAGTTCTCAGCCATGTTCCGGCGCAAGGCCTTCCTGCACTGGTTCACGGGTGAGGGCATGGATGAAATGGAGTTCACCGAGGCGGAGAGCAACATGAACGACCTGGTATCCGAGTACCAGCAGTACCAGGATGCCACCGCCAATGACGGGGAGGAAGCTTTTGAGGATGAGGAAGAGGAGATCGATGGATAGTCGGAATAGAGCCGCCCCAACTCAGATCCTACAACACGCAAGTTCCTTCTTGAACCCTGGTGCCTCCTACCCTATGGCCCTGAATGGTGCACTGGTTTAATTGTGTTGGTGTCGGCCCCTCACAAATGCAGCCAAGTCATGTAATTAGTCATCTGGAACAAAGACTAAAAACAGCAGAGAATTGCGGGTTCTACCCAGTCAGAAGATCACACCATGGAGACTTTCTACTAGAGGACTTGAAAGAGAACTGAGGGGCCACAAAATAAACTTCACCTTCCATTAAGTGTTCAAGCATGTCTGCAAATTAGGAGGGAGTTAGAAACAGTCTTTTTCATCCTTTGTGATGAAGCCTGAAATTGTGCCGTGTTGCCTTATATGAATATGCAGTATGGGACTTTGAAATAATGATTCATAATAAAATACTAAACGTGTGTCTTCA