Transcript asmbl_20946

Sequence
Transcript Sequence for observation asmbl_20946 of TGE0008462:
CGCGTCCGGGATGCTCGCCTGACTGCTGCTGGCTCTGCGCTGAGGGACCCCCGCCACCATGGTCTCCGACGAAGATGAGTTGAATCTTCTAGTCATCATTGTTGATACCAACCCAATTTGGTGGGGAAAGCAAGCATTGAAAGAATCTCAGTTTACTTTATCCAAATGCATAGATGCAGTGATGGTGCTGGGAAATTCTCACTTATTCATGGATCATTCCAACAAACTTGCTGTGATAGCAAGTCATATTCAAGAAAGTCGATTCTTATATCCTGGGAAGAATGGCAGACTTGGGGACCTCTTCGGGGACCCCAGCAACCCTCCATCTGAATTTAATCCCTCGGGGAGTAAAGACGGAAAATATGAGTTGCTCACAGCAGCCAATGAAGTTATCGTTGAAGAGATTAAAGATCTAATGACCAATGGTGACATTAAGGGTCAACATACAGAAACTCTGCTGGCAGGGTCCCTCGCCAAAGCTCTTTGCTACATTCACAGGATGAACAAGGAGGTTAAAGATAATCAAGAAATGAAGTCAAGGATATTGGTGATCAAGGCCGCGGAGGACAGCGCGTTGCAGTATATGAACTTCATGAACGTCATCTTCGCAGCTCAGAAACAGAACATTCTGATCGATGCCTGCGTCTTAGGCTCTGATTCGGGACTCCTTCAGCAGGTACGTGTAAACGAGCGCGTGGCGGGGGCGTGAAGCGTGGTGGTTCTGTTCC