Transcript asmbl_20944

Sequence
Transcript Sequence for observation asmbl_20944 of TGE0008461:
CGCGTCCGGGATGCTCGCCTGACTGCTGCTGGCTCTGCGCTGAGGGACCCCCGCCACCATGGTCTCCGACGTTTACTTTATCCAAATGCATAGATGCAGTGATGGTGCTGGGAAATTCTCACTTATTCATGGATCATTCCAACAAACTTGCTGTGATAGCAAGTCATATTCAAGAAAGTCGATTCTTATATCCTGGGAAGAATGGCAGACTTGGGGACCTCTTCGGGGACCCCAGCAACCCTCCATCTGAATTTAATCCCTCGGGGAGTAAAGACGGAAAATATGAGTTGCTCACAGCAGCCAATGAAGTTATCGTTGAAGAGATTAAAGATCTAATGACCAATGGTGACATTAAGGGTCAACATACAGAAACTCTGCTGGCAGGGTCCCTCGCCAAAGCTCTTTGCTACATTCACAGGATGAACAAGGAGGTTAAAGATAATCAAGAAATGAAGTCAAGGATATTGGTGATCAAGGCCGCGGAGGACAGCGCGTTGCAGTATATGAACTTCATGAACGTCATCTTCGCAGCTCAGAAACAGAACATTCTGATCGATGCCTGCGTCTTAGGCTCTGATTCGGGACTCCTTCAGCAGGCTTGTGACATCACAGGGGGACTGTACTTGAAGGTGCCTCAGATGCCCTCCCTTCTGCAGTATTTACTGTGGGTTTTTCTTCCTGATCAGGATCAGAGGTCTCAGTTAATCCTCCCACCCCCGATACATGTTGACTACCGGGCTGCTTGCTTCTGTCACCGAAATCTTATTGAAATCGGCTATGTCTGTTCTGTGTGCTTGTCAATATTCTGCAATTTCAGCCCTATTTGTACCACATGCGAGACCGCCTTTAAGATTTCTCTGCCTCCCATACTGAAGGCCAAGAAAAAGAAACTGAAAGTGTCTGCATGACGATAAAATTTTTCCTCCAATTTTTAGAGCTATTTAGTCTTTGTTAGGGAGCCTCTGAAAAAAATA