Transcript asmbl_81101

Sequence
Transcript Sequence for observation asmbl_81101 of TGE0056115:
CGGTGTGCCAGGCCGGGGCCAAGTCGGAGGCCCCTCGCTCTGGGTGGGCGCTGGGGCCCGCGAGGGCTACTGTAAGGACCCCTGGCTTCTGAGGATACTGCGTCTAGAACTTTCTCCGTATGGGGCCTTGAGGTGCTTGGTCGAGACCTGCCTTTGCGCTTGGTCCCGAATCCTGCCCTCTAGGAGTCGCTCTTGCGGGCCTCCAGCCCACCGGAGGCGAAGCGGCCCCGGGCGGAAGGCCGCTGGATCCTCGAGGGAGGTGCCGGTTTCTCTCCGCGGGCGCCGTGGGGACGGTGGGAGGCGGGGGCGTCGGCAGCGCTTGGACTAGGTGCGGCCTTGGGCCTGCCTGGTAGCGGGGATTTGGGCCCGCAGAGCGCCCGCCTCTGCGGCTGAGTTCTGCCTGGCGGGGAAGGGAGCGCCCGATGGGTGCCGAGGCGTCCTCCTCTTGGTGCCCTGGCACTGCTCTTCCCGAAGAACGCCTTTCAGTTAAACGGGCGTCGGAAATCTCGGGCTTCCTGGGGCAGGGATCGTCGGGAGAGGCCGCTCTGGACGTGTTGACACACGTGCTGGAGGGGGCAGGAAACAAGCTCACATCTTCCTGTGGGAAACCTTCTAGCAACAGGATGAGTCTGCAGTGGACTGCAGTTGCCACCTTCCTCTATGCGGAGGTCTTTGTTGTGTTGCTTCTCTGCATTCCCTTCATTTCTCCTAAAAGATGGCAGAAGATTTTCAAGTCCCGGCTGGTGGAGTTGTTAGTGTCCTATGGCAACACCTTCTTTGTGGTTCTCATTGTCATCCTTGTGCTGTTGGTCATCGATGCCGTGCGCGAAATTCGGAAGTATGATGATGTGACGGAAAAGGTGAACCTCCAGAACAATCCCGGGGCCATGGAGCACTTCCACATGAAGCTTTTCCGTGCCCAGAGGAATCTCTACATTGCTGGCTTTTCCTTGCTGCTGTCCTTCCTGCTTAGACGCCTGGTGACTCTCATTTCGCAGCAGGCCACGCTGCTGGCCTCCAATGAAGCCTTTAAAAAGCAGGCGGAGAGTGCTAGTGAGGCGGCCAAGAAGTACATGGAGGAGAATGACCAGCTCAAGAAGGGAGCTGCTGTTGACGGAGGCAAGTTGGATGTCGGGAATGCTGAGGTGAAGTTGGAGGAAGAGAACAGGAGCCTGAAGGCTGACCTGCAGAAGCTAAAGGACGAGCTGGCCAGCACTAAGCAAAAACTAGAGAAAGCTGAAAACCAGGTTCTGGCCATGCGGAAGCAGTCTGAGGGCCTCACCAAGGAGTACGACCGCTTGCTGGAGGAGCACGCAAAGCTGCAGGCTGCAGTAGATGGTCCCATGGACAAGAAGGAAGAGTAAGGGCCTCCTTCCTCCCCTGCCTGCAGCTGGCTTCCACCTGGCACGTGCCTGCTGCTTCCTGAGAGCCCGGCCTCTCCCTCCAGTACTTCTGTTTGTGCCCTTCTGCTTCCCCCATTCCCTTCCACAGCTCATAGCTCGTCATCTCGGCCCTTGTCCACACTCTCCAAGCACATTACAGGGGACCTGATTGCTACACGTTCAGAATGCGTTTGCTGTCATCCTGCTTGGCCTGGCCAGGCCTGGCACAGCCTTGGCTTCCACGCCTGAGCGTGGAGAGCACGAGTTAGTTGTAGTCCGGCTTGCGGTGGGGCTGACTTCCTGTTGGTTTGAGCCCCTTTTTGTTTTGCCCTCTGGGTGTTTTCTTTGGTCCCGCAGGAGGGTGGGTGGAGCAGGTGGACTGGAGTTTCTCTTGAGGGCAATAAAAGTTGTCATGGTGTGTACGTGGTGCGGTGTGTGACTGCAGCTGTGGGGAGGGCTCTGCTTTCTCTCCTGCCTGGAGCCCCCAAGCGGCCACAGCCCTTCAACCTGTTTCCCCCACTGAAGGCCAGGCTCACACCTGTTCTCGAAGGCCTTGCCCTCTCTGTCCTCCTGCTCCCCGGGCTGGGCCAGGCCTCGCTTCAGGGCCACCCGCCGAGTGTGTGTCCTGTCTGCCTCCCTGGGTGTGGGC