Transcript asmbl_77095

Sequence
Transcript Sequence for observation asmbl_77095 of TGE0002774:
TGAGTACCGCGGCCCCCGCCGGAAGGAGTCGGGCGCGACAGAGACGCCCGAGGGGCCGGGAGGGCGGGCGGCCCGGGCTGCGCCAGAAGCTCGCGCCGTTAGGGACTGAGGCACAAGTGCGCCAGCGCGGGCTTAGGGGCCGTGGGCCAAGTGCGGCACTTGGGGCGAGCGCAGAGAGGCGGGGCGACGGAGGCCACGTGGCCGGCTTGGAGGGCGTCCGCGGGACGGGGGCGCCGGGAGCACTGTCTCACGGCGCATCCCGGTCGTGGAAGCCCCTCGGCCAGGCTGCTGGGGCCTAAGGCCTGTGTTTGCTGCCGTCTCCGTGGGAGACCAGACATCTGCCCCAGCTGTTTCTCTGGCCTGCAGACCTTCGTACACCACGTCTTTGTCAAGCACCAGTTACTGCACGCATCAGCTGAGCACGGAGGGGATAGGCACGGACGCAACACTTTTGGAACTTAGACGCTACAGAAAAATGGCTACAAACTTCCTAGCACATGAGAAGATCTGGTTCGACAAGTTCAAATATGACGACGCAGAAAGGAGATTCTACGAGCAGATGAACGGGCCTGTGGCAGGTGCCTCCCGCCAGGAGAACGGCGCCAGCGTGATCCTCCGTGACATTGCGAGAGCCAGAGAGAACATCCAGAAATCCCTGGCTGGAAGCTCAGGCCCCGGGGCCTCCAGCGGCACCAGCGGAGACCACGGTGAGCTCGTCGTCCGGATTGCCAGTCTGGAAGTGGAGAACCAGAGTCTGCGTGGCGTGGTACAGGAGCTGCAGCAGGCCATCTCCAAGCTGGAGGCCCGGCTGAACGTGCTGGAGAAGAGCTCGCCTGGCCACCGGGCCACGGCCCCACAGACCCAGCACGTATCTCCCATGCGCCAAGTGGAGCCCCCAGCCAAGAAGCCAGCCACACCAGCAGAGGATGACGAGGATGATGACATTGACCTGTTTGGCAGTGACAATGAGGAGGAGGACAAGGAGGCGGCACAGCTGCGGGAGGAGCGGCTACGGCAGTACGCGGAGAAGAAGGCCAAGAAGCCTGCACTGGTGGCCAAGTCCTCCATCCTGCTGGATGTCAAGCCTTGGGATGATGAGACGGACATGGCCCAGCTGGAGGCCTGTGTGCGCTCTATCCAGCTGGACGGGCTGGTCTGGGGGGCTTCCAAGCTGGTGCCCGTGGGCTACGGTATCCGGAAGCTACAGATTCAGTGTGTGGTGGAGGACGACAAGGTGGGGACAGACTTGCTGGAGGAGGAGATCACCAAGTTTGAGGAGCACGTGCAGAGTGTCGATATCGCAGCTTTCAACAAGATCTGAAGCCTGAGTGTGTGTACGTGCGCGCGTGCGTGAGGCCCTGCCACGATTAAAGACTGAGACCGGC