Transcript asmbl_2085

Sequence
Transcript Sequence for observation asmbl_2085 of TGE0004118:
CAGAGCCTGGCTCAGCTAGAGAATCTGTGCAAACAGCTGTATGAAACCACAGATACAACCACTCGACTCCAGGCAGAAAAAGCCTTGGTTGAATTCACCAACAGCCCTGATTGCCTGAGCAAGTGCCAGCTACTCCTTGAAAGAGGAAGTTCATCGTATTCCCAGTTACTGGCAGCTACATGCCTTACAAAGCTTGTATCACGCACAAACAACCCTCTACCATTGGAACAACGAATAGATATTCGAAATTATGTGCTCAACTACCTTGCCACTCGGCCAAAGTTGGCTACTTTTGTGACACAAGCACTAATTCAGTTATATGCCAGAATCACAAAACTGGGCTGGTTTGACTGTCAGAAGGATGACTATGTCTTCAGAAATGCAATCACAGATGTCACAAGGTTTTTACAGGATAGTGTTGAATACTGCATCATTGGCGTCACAATTTTATCTCAGCTAACCAATGAAATTAATCAAGCAGACACCACCCATCCTTTAACCAAGCACAGAAAAATAGCCTCTTCTTTCCGAGATTCATCATTATTTGACATCTTCACACTTTCCTGCAATTTACTAAAACAGGCTTCGGGAAAGAATCTAAACTTGAATGATGAAAGCCAGCATGGTTTACTCATGCAACTGCTCAAACTCACTCATAACTGCCTAAACTTTGATTTCATCGGCACTTCTACTGATGAGTCCTCAGATGACCTGTGCACAGTACAGATCCCCACCAGCTGGAGATCAGCATTCTTAGATTCTTCAACTCTGCAGCTGTTTTTTGACCTGTATCATTCCATCCCTCCTTCATTTTCACCCCTGGTATTATCCTGCTTAGTACAGATTGCCTCAGTTAGAAGATCCCTGTTTAACAATGCAGAGAGAGCCAAGTTTCTCTCTCATCTTGTTGATGGTGTTAAACGAATACTGGAAAATCCACAGAGTTTATCAGACCCAAACAATTACCATGAGTTTTGCAGACTACTGGCCCGACTGAAGAGTAACTATCAACTGGGAGAGTTAGTAAAGGTGGAAAACTACCCTGAGGTCATCCGATTGATAGCTAACTTCACAGTGACCAGTCTACAGCACTGGGAATTTGCCCCAAATAGTGTGCACTATCTCCTGAGCCTATGGCAGCGGCTGGCAGCCTCTGTGCCATACGTGAAAGCCACAGAGCCCCACATGCTGGAAACTTATACTCCTGAAGTCACCAAAGCCTACATCACATCCCGTTTGGAATCTGTGCATATCATATTGAGAGATGGACTGGAAGATCCTCTGGAGGATACAGGTCTGGTCCAGCAGCAGTTGGACCAGCTGTCTACAATTGGACGTTGTGAATACGAGAAGACGTGTGCGCTCCTCGTGCAGTTGTTTGACCAGTCGGCCCAGTCCTATCAGGAGCTGCTACAGAGTGCCAGCGCAAGCCCAATGGATATTGCAGTGCAGGAAGGGAGGCTGACATGGCTGGTTTACATCATTGGCGCAGTAATAGGTGGCCGGGTCTCTTTTGCCAGCACTGATGAGCAAGATGCTATGGATGGCGAGCTTGTCTGTCGGGTGCTCCAGCTGATGAACCTAACAGATTCTCGCTTGGCTCAGGCAGGCAACGAGAAGCTAGAACTGGCCATGCTGAGCTTTTTTGAACAGTTTCGTAAGATCTACATTGGGGACCAGGTGCAAAAATCCTCTAAGCTGTACCGACGACTCTCAGAAGTTCTGGGCTTAAATGATGAGACCATGGTCCTGAGTGTCTTCATTGGAAAAATCATCACCAACCTGAAGTACTGGGGCCGCTGCGAGCCAATCACCTCCAAGACGCTACAGCTTCTCAATGACCTCTCCATTGGATACAGTAGTGTAAGGAAACTAGTGAAGCTTAGTGCGGTACAGTTCATGCTGAACAATCACACGAGCGAGCACTTTTCATTTTTGGGTATTAACAATCAGTCCAACCTGACAGACATGCGGTGTCGGACGACCTTCTACACAGCACTTGGGCGTCTCCTCATGGTGGATTTAGGAGAGGATGAAGATCAGTATGAACAATTCATGCTTCCACTCACAGCAGCGTTTGAGGCTGTAGCCCAGATGTTTAGCACGAATAGTTTCAATGAGCAAGAGGCGAAGCGAACTCTAGTTGGCCTAGTAAGAGACCTGAGAGGAATAGCTTTCGCCTTCAATGCCAAGACCAGCTTCATGATGCTGTTTGAATGGATATACCCATCCTACATGCCAATTCTCCAGCGCGCAATTGAGCTATGGTACCATGATCCAGCCTGTACCACACCCGTGCTCAAGCTGATGGCTGAATTAGTTCATAATAGATCCCAGCGACTCCAGTTTGATGTCTCTTCCCCCAATGGCATCTTACTCTTCAGAGAAACCAGCAAGATGATAACAATGTATGGCAATCGCATCCTGACACTAGGAGAGGTCCCAAAGGATCAGGTCTATGCACTGAAGCTCAAGGGCATCTCCATCTGCTTCTCTATGCTGAAGGCTGCTCTCAGTGGGAGTTATGTCAACTTTGGAGTCTTCCGTCTCTATGGAGACGATGCCCTGGACAACGCTCTCCAGACCTTCATCAAGCTGCTCCTCTCCATTCCCCACAGCGACCTCCTGGACTACCCCAAGCTCAGCCAGTCTTACTACTCACTGCTGGAAGTCCTGACCCAGGACCACATGAACTTCATTGCAAGCCTGGAACCTCACGTCATCATGTATATTCTCTCTTCCATATCTGAAGGACTCACTGCACTTGACACCATGGTTTGTACAGGCTGCTGCTCCTGCCTGGACCACATCGTGACATACCTCTTTAAGCAGCTGTCACGTAGCACCAAGAAGAGGACAACACCCCTGAACCAGGAGAGTGACCGCTTTCTGCATATCATGCAGCAGCATCCAGAGATGATCCAGCAGATGCTGTCAACGGTGCTGAACATCATCATCTTCGAAGACTGTAGGAACCAGTGGTCTATGTCCCGACCGCTACTGGGCTTGATACTACTTAATGAAAAGTATTTTTCTGACCTAAGGAACAGTATCGTGAACAGCCAGCCACCAGAGAAGCAGCAGGCTATGCATCTGTGTTTTGAAAACCTGATGGAAGGCATAGAGCGAAATCTTCTCACAAAAAACAGAGACAGGTTCACCCAGAACCTGTCAGCATTCCGTCGAGAAGTCAACGACTCGATGAAGAACTCCACTTACGGCGTGAATAGCAATGACATGATGAGCTGACACCTCCTTGGAATCTACCTGTACAGAGCAGCGTCCCTTCGGTCTGGCCCAGAGGGGCGAACAATTACAAGGGAGAGGGCCTGGCTGATCCTGGCGCCCTTCTCCAGGGGTGTGGAGAAAATGGCAAAGGTCAACTAGCTGTTTCCCCAGGGAATAGGGGTGTGAGTGCACTCACTAGGGGGCAGGGCGCTGCTGGTTCTTGGGGGATGGGGTGGGAAGGGTGGTGGGAGGAGATAGAGACACAAATATGTGAG