Transcript asmbl_74314

Sequence
Transcript Sequence for observation asmbl_74314 of TGE0002774:
TGAGTACCGCGGCCCCCGCCGGAAGGAGTCGGGCGCGACAGAGACGCCCGAGGGGCCGGGAGGGCGGGCGGCCCGGGCTGCGCCAGAAGCTCGCGCCGTTAGGGACTGAGGCACAAGTGCGCCAGCGCGGGCTTAGGGGCCGTGGGCCAAGTGCGGCACTTGGGGCGAGCGCAGAGAGGCGGGGCGACGGAGGCCACGTGGCCGGCTTGGAGGGCGTCCGCGGGACGGGGGCGCCGGGAGCACTGTCTCACGGCGCATCCCGGTCGTGGAAGCCCCTCGGCCAGGCTGCTGGGGCCTAAGGCCTGTGTTTGCTGCCGTCTCCGTGGGAGACCAGACATCTGCCCCAGCTGTTTCTCTGGCCTGCAGACCTTCGTACACCACGTCTTTGTCAAGCACCAGTTACTGCACGCATCAGCTGAGCACGGAGGGGATAGGCACGGACGCAACACTTTTGGAACTTAGACGCTACAGAAAAATGGCTACAAACTTCCTAGCACATGAGAAGATCTGGTTCGACAAGTTCAAATATGACGACGCAGAAAGGAGATTCTACGAGCAGATGAACGGGCCTGTGGCAGGTGCCTCCCGCCAGGAGAACGGCGCCAGCGTGATCCTCCGTGACATTGCGAGAGCCAGAGAGAACATCCAGAAATCCCTGGCTGGAAGCTCAGGCCCCGGGGCCTCCAGCGGCACCAGCGGAGACCACGGTGAGCTCGTCGTCCGGATTGCCAGTCTGGAAGTGGAGAACCAGAGTCTGCGTGGCGTGGTACAGGAGCTGCAGCAGGCCATCTCCAAGCTGGAGGCCCGGCTGAACGTGCTGGAGAAGAGCTCGCCTGGCCACCGGGCCACGGCCCCACAGACCCAGCACGTATCTCCCATGCGCCAAGTGGAGCCCCCAGCCAAGAAGCCAGCCACACCAGCAGAGGATGACGAGGATGATGACATTGACCTGTTTGGCAGTGACAATGAGGAGGAGGACAAGGAGGCGGCACAGCTGCGGGAGGAGCGGCTACGGCAGTACGCGGAGAAGAAGGCCAAGAAGCCTGCACTGGTGGCCAAGTCCTCCATCCTGCTGGATGTCAAGCCTTGGGATGATGAGACGGACATGGCCCAGCTGGAGGCCTGTGTGCGCTCTATCCAGCTGGACGGGCTGGTCTGGGGGGCTTCCAAGCTGGTGCCCGTGGGCTACGGTATCCGGAAGCTACAGATTCAGTGTGTGGTGGAGGACGACAAGGTGGGGACAGACTTGCTGGAGGAGGAGATCACCAAGTTTGAGGAGCACGTGCAGAGTGTCGATATCGCAGCTTTCAACAAGATCTGAAGCCTGAGTGTGTGTACGTGCGCGCGTGCGTGAGGCCCTGCCACGATTAAAGACTGAGACCGGC