Transcript asmbl_73463

Sequence
Transcript Sequence for observation asmbl_73463 of TGE0002707:
GGAGGCGGGAGCTCAGGACCGGCGCCTTCTCCTTGCTTCTGGGGGTCGTGGCCTTGCTCCCGCTGTGCGGGAAAAGAATCCAGGCCCTTCCACGCGCGTGTGGGTGCGGGGGCCCCGAAGTGCTCGTGGTTCCCCGCTAGGTCTCCGCTGGGGCAGGAACCGGAATCATGGGTGGGACCACCAGCACCCGCCGGGTCACCTTCGAGGCGGACGAGAATGAGAACATCACCGTGGTGAAGGGCATCCGGCTTTCGGAAAATGTGATTGATCGAATGAAGGAATCCTCTCCATCTGGTTCGAAGTCTCAGCGGTATTCTGGTGCTTATGGTGCCTCAGTTTCTGATGAAGAATTGAAAAGAAGAGTAGCTGAGGAGCTGGCATTGGAGCAAGCCAAGAAAGAATCCGAAGATCAGAAACGACTAAAGCAAGCCAAAGAGCTGGACCGAGAGAGGGCTGCTGCCAATGAGCAGTTAACCAGAGCCATCCTTCGGGAGAGGATATGTAGCGAGGAGGAACGCGCTAAGGCAAAGCACCTGGCTAGGCAGCTGGAAGAGAAAGACCGAGTGCTAAAGAAGCAGGATGCATTCTACAAAGAACAGCTGGCTAGACTGGAGGAGAGGAGCTCAGAGTTCTACAGAGTCACCACTGAACAATATCAGAAAGCTGCTGAAGAGGTGGAAGCAAAGTTCAAGCGATATGAGTCTCATCCAGTCTGTGCTGATCTGCAGGCCAAAATTCTTCAGTGTTACCGTGAGAACACCCACCAGACCCTCAAATGCTCCGCTCTGGCCACCCAGTATATGCACTGTGTCAATCATGCCAAACAGAGCATGCTTGAGAAGGGAGGATAAAAACTTTCAGAATGAGCAAAACACCATCAACGTTAATTCCAGAGATGGAACATTTTTTTTCCTAGTGAGAAAACAACCCATTTGAAGAGAAGACCACTAATGAGAAGACCACTAAAGAGAGACATCAAGAATGGATTCAGCAGAATCATTTCACGTTTTGAACAGCAGCAGTTTGAAGGGCCAAAGCCTTGATCAGGGATCAGTCATTAAAGGACACTCTTGAGTATTAGTAAACCCTCTTATGATGATTAAAAGAGAAGGGCAGCCCTCTCCACCTTTTGGTACTTTCTATTCAACTTGCACTGACCATAAAATGTTTCTCTTCTGAACAAGCCCCATCATTTGGTGAACCTCCACCCTAACAAAGTAGGATGGGGTTGGGGGCTAAATTAATTGGAGTGGGGCGAGGAGAGAGCCAGAAAACATAGATCCGAGGGCAGCAGTGCTGGGTGGAGAGAGCCAGAAAACAGATCTGGAGGCAGCAGTGCTGGATGGAATTGTCTAGGCTGTGGCATGTTGGTTTTGTCTTTCTTTTCTCCTTTGATTATGTAAGAGCTATTTCATTATAACTTATTATGGTGATTATACAGGCAAGAAGACAAAAAGGAGAGAAAATGTACCTCTTCTACTGGAATAATGTTTATGATTACAAGTGAGATAAGGTATTTTTATCAATATGAAGGCAACCTTGGCTGATAAAACCTCTATAGTGAATACTCACATCTTTACTTCACTCACTATCAATAATAAATATATTTTCTGACAAAGACTGGCATTGTAGCTCCTCACACATTCCTTTGGCTGGGTTAGATGTCTATGCTTACGGGAATTGAGCTGATTTATATTGTTAATAATTTGCATTTGTGCTGTACCTTTCCT